Mutagenetix > Incidental Mutation

Incidental Mutation 'R8039:Agrn'

618393

Institutional Source

Beutler Lab

Gene Symbol

Agrn

Ensembl Gene

ENSMUSG00000041936

Gene Name

agrin

Synonyms

NMF380, Agrin, nmf380

MMRRC Submission

Accession Numbers

Genbank: NM_021604; MGI: 87961

Essential gene?

Possibly non essential (E-score: 0.367) question?

Stock #

R8039 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

156165290-156197488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 156169011 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1808 (T1808A)

Ref Sequence

ENSEMBL: ENSMUSP00000137931 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071248] [ENSMUST00000105574] [ENSMUST00000105575] [ENSMUST00000180572]

AlphaFold

A2ASQ1

Predicted Effect

probably benign
Transcript: ENSMUST00000071248

SMART Domains

Protein: ENSMUSP00000071229
Gene: ENSMUSG00000041936

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
FOLN	66	91	8.25e-6	SMART
KAZAL	91	137	1.22e-17	SMART
FOLN	142	166	7.58e-5	SMART
EGF_like	142	181	7.38e1	SMART
KAZAL	166	212	1.51e-13	SMART
KAZAL	241	284	1.8e-6	SMART
KAZAL	310	356	1.55e-10	SMART
FOLN	362	384	8.25e-6	SMART
KAZAL	384	429	1.14e-17	SMART
KAZAL	449	494	6.43e-17	SMART
FOLN	496	519	2.94e-2	SMART
KAZAL	507	559	8.96e-16	SMART
low complexity region	565	572	N/A	INTRINSIC
KAZAL	599	645	1.12e-16	SMART
EGF_Lam	688	739	3.29e-15	SMART
EGF_Lam	742	786	6.7e-7	SMART
FOLN	795	817	1.94e-2	SMART
KAZAL	817	864	3.9e-16	SMART
low complexity region	889	906	N/A	INTRINSIC
low complexity region	949	978	N/A	INTRINSIC
SEA	1014	1139	5.57e-35	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105574
AA Change: T1701A

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101199
Gene: ENSMUSG00000041936
AA Change: T1701A

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
FOLN	66	91	8.25e-6	SMART
KAZAL	91	137	1.22e-17	SMART
FOLN	142	166	7.58e-5	SMART
EGF_like	142	181	7.38e1	SMART
KAZAL	166	212	1.51e-13	SMART
KAZAL	241	284	1.8e-6	SMART
KAZAL	310	356	1.55e-10	SMART
FOLN	362	384	8.25e-6	SMART
KAZAL	384	429	1.14e-17	SMART
KAZAL	449	494	6.43e-17	SMART
FOLN	496	519	2.94e-2	SMART
KAZAL	507	559	8.96e-16	SMART
low complexity region	565	572	N/A	INTRINSIC
KAZAL	599	645	1.12e-16	SMART
EGF_Lam	688	739	3.29e-15	SMART
EGF_Lam	742	786	6.7e-7	SMART
FOLN	795	817	1.94e-2	SMART
KAZAL	817	864	3.9e-16	SMART
low complexity region	889	906	N/A	INTRINSIC
low complexity region	949	978	N/A	INTRINSIC
SEA	1014	1136	2.26e-35	SMART
low complexity region	1142	1169	N/A	INTRINSIC
low complexity region	1183	1198	N/A	INTRINSIC
EGF	1214	1249	1.49e-4	SMART
LamG	1274	1410	4e-45	SMART
EGF	1434	1468	2.23e-3	SMART
EGF	1473	1507	7.13e-2	SMART
LamG	1542	1678	6.51e-36	SMART
EGF	1699	1735	4.35e-6	SMART
LamG	1771	1907	5.01e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105575
AA Change: T1705A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000101200
Gene: ENSMUSG00000041936
AA Change: T1705A

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
FOLN	66	91	8.25e-6	SMART
KAZAL	91	137	1.22e-17	SMART
FOLN	142	166	7.58e-5	SMART
EGF_like	142	181	7.38e1	SMART
KAZAL	166	212	1.51e-13	SMART
KAZAL	241	284	1.8e-6	SMART
KAZAL	310	356	1.55e-10	SMART
FOLN	362	384	8.25e-6	SMART
KAZAL	384	429	1.14e-17	SMART
KAZAL	449	494	6.43e-17	SMART
FOLN	496	519	2.94e-2	SMART
KAZAL	507	559	8.96e-16	SMART
low complexity region	565	572	N/A	INTRINSIC
KAZAL	599	645	1.12e-16	SMART
EGF_Lam	688	739	3.29e-15	SMART
EGF_Lam	742	786	6.7e-7	SMART
FOLN	795	817	1.94e-2	SMART
KAZAL	817	864	3.9e-16	SMART
low complexity region	889	906	N/A	INTRINSIC
low complexity region	949	978	N/A	INTRINSIC
SEA	1014	1136	2.26e-35	SMART
low complexity region	1142	1169	N/A	INTRINSIC
low complexity region	1183	1198	N/A	INTRINSIC
EGF	1214	1249	1.49e-4	SMART
LamG	1274	1410	4e-45	SMART
EGF	1434	1468	2.23e-3	SMART
EGF	1473	1507	7.13e-2	SMART
LamG	1542	1682	9.2e-36	SMART
EGF	1703	1739	4.35e-6	SMART
LamG	1794	1930	5.01e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000180572
AA Change: T1808A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000137931
Gene: ENSMUSG00000041936
AA Change: T1808A

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:NtA	32	159	5.1e-91	PFAM
FOLN	173	198	8.25e-6	SMART
KAZAL	198	244	1.22e-17	SMART
FOLN	249	273	7.58e-5	SMART
EGF_like	249	288	7.38e1	SMART
KAZAL	273	319	1.51e-13	SMART
KAZAL	348	391	1.8e-6	SMART
KAZAL	417	463	1.55e-10	SMART
FOLN	469	491	8.25e-6	SMART
KAZAL	491	536	1.14e-17	SMART
KAZAL	556	601	6.43e-17	SMART
FOLN	603	626	2.94e-2	SMART
KAZAL	614	666	8.96e-16	SMART
low complexity region	672	679	N/A	INTRINSIC
KAZAL	706	752	1.12e-16	SMART
EGF_Lam	795	846	3.29e-15	SMART
EGF_Lam	849	893	6.7e-7	SMART
FOLN	902	924	1.94e-2	SMART
KAZAL	924	971	3.9e-16	SMART
low complexity region	996	1013	N/A	INTRINSIC
low complexity region	1056	1085	N/A	INTRINSIC
SEA	1121	1243	2.26e-35	SMART
low complexity region	1249	1276	N/A	INTRINSIC
low complexity region	1290	1305	N/A	INTRINSIC
EGF	1321	1356	1.49e-4	SMART
LamG	1381	1517	4e-45	SMART
EGF	1541	1575	2.23e-3	SMART
EGF	1580	1614	7.13e-2	SMART
LamG	1649	1785	6.51e-36	SMART
EGF	1806	1842	4.35e-6	SMART
LamG	1878	2014	5.01e-37	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several proteins that are critical in the development of the neuromuscular junction (NMJ), as identified in mouse knock-out studies. The encoded protein contains several laminin G, Kazal type serine protease inhibitor, and epidermal growth factor domains. Additional post-translational modifications occur to add glycosaminoglycans and disulfide bonds. In one family with congenital myasthenic syndrome affecting limb-girdle muscles, a mutation in this gene was found. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Nullizygous mice display embryonic failure of NMJ formation, inability to breathe or move and perinatal lethality. Homozygotes for an ENU-induced allele show poor hindlimb motor control, myopathy, muscle atrophy, spasms and fiber-type switching, NMJ disaggregation, camptodactyly and premature death. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(1) Gene trapped(7)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,943,214	V1140E	probably benign	Het
Abca17	T	C	17: 24,328,725	H225R	probably damaging	Het
Adgrb2	T	A	4: 130,022,268	L1451Q	probably damaging	Het
Afdn	T	C	17: 13,899,141	L1713P	probably damaging	Het
Agr2	A	T	12: 35,995,559	I15F	probably benign	Het
Akap6	A	G	12: 53,141,676	I1958V	probably benign	Het
Ankrd60	C	A	2: 173,572,491		probably null	Het
Anpep	A	G	7: 79,839,400		probably null	Het
Apoa4	A	T	9: 46,242,293	D64V	possibly damaging	Het
Arhgef26	C	A	3: 62,339,930	T145N	probably benign	Het
Art1	A	T	7: 102,106,845	Q81L	probably benign	Het
Astl	A	T	2: 127,343,983	S71C	probably damaging	Het
Atp2a1	A	G	7: 126,448,805	I611T	probably damaging	Het
Cacna2d2	T	A	9: 107,527,433	V1139D	possibly damaging	Het
Chst10	T	A	1: 38,866,031	K198*	probably null	Het
Ckmt2	G	A	13: 91,863,312	H60Y	possibly damaging	Het
Coq7	G	C	7: 118,533,246	S2R	possibly damaging	Het
Cspp1	T	A	1: 10,113,013	D814E	probably benign	Het
Cyp2c54	CCTCTTTCATAGCTCT	CCTCT	19: 40,073,732		probably null	Het
Daam2	C	A	17: 49,464,538	G860V	probably damaging	Het
Ecm2	A	T	13: 49,514,850	I10F	probably benign	Het
Epb41l1	A	T	2: 156,506,412	D312V	probably damaging	Het
Epsti1	G	A	14: 77,931,301	R126H	probably damaging	Het
Erc1	A	T	6: 119,773,665	Y367*	probably null	Het
Erh	T	A	12: 80,637,578	R42W	probably damaging	Het
Fam124a	C	T	14: 62,605,876	Q278*	probably null	Het
Fam155a	T	C	8: 9,207,892	T419A	probably benign	Het
Fbxo3	T	A	2: 104,054,941	L385Q	probably damaging	Het
Fbxo31	T	A	8: 121,559,055	T219S	probably damaging	Het
Fstl5	T	G	3: 76,648,418	V534G	possibly damaging	Het
Gatsl3	G	T	11: 4,221,639	A288S	probably damaging	Het
Gbp2b	A	T	3: 142,618,164	I577F	probably benign	Het
Gbp8	A	T	5: 105,050,917	L44*	probably null	Het
Gck	C	T	11: 5,910,301	A114T	probably benign	Het
Gm16486	T	C	8: 70,710,906	V916A	probably benign	Het
Gtf2i	A	G	5: 134,255,834	V537A	possibly damaging	Het
Iqcm	C	A	8: 75,763,105	H400Q	probably damaging	Het
Itpr1	T	C	6: 108,386,628	L737P	probably damaging	Het
Jakmip1	A	G	5: 37,100,772	E254G	probably damaging	Het
Kif15	A	T	9: 123,007,425	R1095W	possibly damaging	Het
Klhdc8a	G	A	1: 132,303,108	R237Q	probably benign	Het
Klhl38	T	C	15: 58,322,862	E157G	probably benign	Het
Klrk1	T	A	6: 129,612,823	N221I	probably benign	Het
Lhx8	A	T	3: 154,306,939	H345Q	probably damaging	Het
Lims1	T	A	10: 58,409,672	N174K	probably benign	Het
Madd	T	A	2: 91,167,061	Q754L	probably benign	Het
Mau2	T	C	8: 70,019,790	D581G	probably damaging	Het
Miga1	A	T	3: 152,276,756	I561N	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mob3c	T	C	4: 115,831,687	V139A	probably benign	Het
Nadk	G	T	4: 155,577,067	D17Y	probably benign	Het
Ncapd2	C	T	6: 125,181,026	V380I	probably damaging	Het
Nes	G	A	3: 87,977,008	R858K	probably benign	Het
Nphp3	T	C	9: 104,031,963	S791P	probably benign	Het
Nup210	T	C	6: 91,070,233	T496A	probably benign	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,595,266		probably benign	Het
Olfr1186	C	T	2: 88,525,871	T96I	probably benign	Het
Olfr220	T	A	1: 174,449,596	S324R	unknown	Het
Olfr914	T	A	9: 38,607,389	M308K	probably benign	Het
Ovgp1	T	A	3: 105,976,023	S105T	probably benign	Het
Pbld2	T	A	10: 63,047,992	C79S	probably damaging	Het
Pik3cd	T	A	4: 149,659,866	M143L	possibly damaging	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Poln	A	G	5: 34,122,672	V282A	probably benign	Het
Ppp1r11	T	C	17: 36,951,446	T21A	probably damaging	Het
Prpf8	T	A	11: 75,502,542	I1664N	possibly damaging	Het
Prr29	C	T	11: 106,376,912	A161V	probably benign	Het
Rasa3	T	C	8: 13,588,931	D292G	probably damaging	Het
Rnf25	T	C	1: 74,593,964	T411A	probably damaging	Het
Rraga	C	T	4: 86,575,980	T21I	probably damaging	Het
Setdb2	T	A	14: 59,402,375	Y673F	probably damaging	Het
Sf3a1	C	T	11: 4,167,787	T183I	probably damaging	Het
Shank3	A	T	15: 89,505,439	H413L	probably damaging	Het
Slc30a5	A	G	13: 100,813,681		probably null	Het
Slc6a18	T	C	13: 73,665,626	S523G	probably benign	Het
Spaca1	C	T	4: 34,044,207	V96I	probably damaging	Het
Sycp2	C	T	2: 178,374,585	A695T	probably benign	Het
Tnrc18	C	A	5: 142,732,052	G2216C	unknown	Het
Trak2	T	C	1: 58,946,288	N17S	probably benign	Het
Ttn	T	A	2: 76,878,432	N8792I	unknown	Het
Ttyh1	T	C	7: 4,122,541	V64A	probably benign	Het
Usb1	T	A	8: 95,333,413	S50R	probably damaging	Het
Ush2a	T	A	1: 188,957,373	I5044N	probably damaging	Het
Vmn1r84	A	T	7: 12,362,008	F253I	possibly damaging	Het
Vmn2r99	T	C	17: 19,380,040	I442T	probably benign	Het
Vsig1	C	T	X: 140,933,126	H232Y	probably benign	Het

Other mutations in Agrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Agrn	APN	4	156170572	splice site	probably benign
IGL00811:Agrn	APN	4	156168774	missense	possibly damaging	0.70
IGL01066:Agrn	APN	4	156177343	missense	probably benign	0.00
IGL01412:Agrn	APN	4	156171034	splice site	probably benign
IGL01414:Agrn	APN	4	156195239	splice site	probably null
IGL02075:Agrn	APN	4	156170210	missense	probably benign	0.40
IGL02609:Agrn	APN	4	156175223	splice site	probably benign
IGL02669:Agrn	APN	4	156174561	splice site	probably benign
IGL02671:Agrn	APN	4	156174561	splice site	probably benign
IGL02672:Agrn	APN	4	156174561	splice site	probably benign
IGL02674:Agrn	APN	4	156174561	splice site	probably benign
IGL02724:Agrn	APN	4	156172807	nonsense	probably null
IGL02804:Agrn	APN	4	156174055	missense	probably benign	0.00
IGL02986:Agrn	APN	4	156178854	missense	possibly damaging	0.84
IGL03160:Agrn	APN	4	156170363	missense	probably damaging	0.98
BB004:Agrn	UTSW	4	156172809	missense	probably damaging	0.99
BB014:Agrn	UTSW	4	156172809	missense	probably damaging	0.99
F6893:Agrn	UTSW	4	156174179	missense	probably benign
R0092:Agrn	UTSW	4	156178953	missense	probably damaging	1.00
R0100:Agrn	UTSW	4	156174958	missense	probably damaging	1.00
R0100:Agrn	UTSW	4	156174958	missense	probably damaging	1.00
R0482:Agrn	UTSW	4	156173555	missense	probably damaging	0.98
R0531:Agrn	UTSW	4	156179434	missense	probably benign	0.38
R0536:Agrn	UTSW	4	156179553	missense	probably benign	0.01
R0690:Agrn	UTSW	4	156174453	missense	probably damaging	1.00
R0750:Agrn	UTSW	4	156166937	nonsense	probably null
R1079:Agrn	UTSW	4	156177225	missense	probably damaging	1.00
R1199:Agrn	UTSW	4	156172299	missense	probably benign	0.00
R1222:Agrn	UTSW	4	156177385	missense	probably damaging	0.99
R1534:Agrn	UTSW	4	156176684	missense	probably damaging	1.00
R1587:Agrn	UTSW	4	156179440	missense	probably damaging	0.99
R1625:Agrn	UTSW	4	156172860	missense	probably damaging	1.00
R1698:Agrn	UTSW	4	156166558	missense	probably benign	0.03
R1717:Agrn	UTSW	4	156166519	frame shift	probably null
R1718:Agrn	UTSW	4	156166519	frame shift	probably null
R1721:Agrn	UTSW	4	156175173	nonsense	probably null
R1765:Agrn	UTSW	4	156176827	nonsense	probably null
R1840:Agrn	UTSW	4	156167415	missense	probably damaging	1.00
R1865:Agrn	UTSW	4	156166519	frame shift	probably null
R2105:Agrn	UTSW	4	156177299	nonsense	probably null
R2265:Agrn	UTSW	4	156179218	missense	probably damaging	0.99
R2266:Agrn	UTSW	4	156179218	missense	probably damaging	0.99
R2269:Agrn	UTSW	4	156179218	missense	probably damaging	0.99
R2382:Agrn	UTSW	4	156176516	missense	probably damaging	0.97
R2497:Agrn	UTSW	4	156173811	missense	probably benign	0.28
R2509:Agrn	UTSW	4	156166424	splice site	probably null
R2510:Agrn	UTSW	4	156166424	splice site	probably null
R2511:Agrn	UTSW	4	156166424	splice site	probably null
R2994:Agrn	UTSW	4	156167328	missense	possibly damaging	0.79
R3824:Agrn	UTSW	4	156169302	missense	probably damaging	1.00
R4736:Agrn	UTSW	4	156172401	missense	probably benign	0.38
R4755:Agrn	UTSW	4	156173522	intron	probably benign
R4853:Agrn	UTSW	4	156185550	critical splice donor site	probably null
R4878:Agrn	UTSW	4	156170845	missense	probably damaging	1.00
R5117:Agrn	UTSW	4	156185553	missense	probably benign	0.30
R5228:Agrn	UTSW	4	156166946	missense	probably damaging	1.00
R5236:Agrn	UTSW	4	156178858	missense	possibly damaging	0.93
R5269:Agrn	UTSW	4	156168990	missense	probably benign	0.10
R5282:Agrn	UTSW	4	156173035	missense	probably damaging	1.00
R5449:Agrn	UTSW	4	156167280	critical splice donor site	probably null
R5560:Agrn	UTSW	4	156178497	missense	probably damaging	0.99
R5668:Agrn	UTSW	4	156167313	missense	probably damaging	0.97
R5725:Agrn	UTSW	4	156173875	missense	probably benign	0.25
R5967:Agrn	UTSW	4	156175103	missense	probably damaging	1.00
R6226:Agrn	UTSW	4	156173609	missense	probably damaging	0.96
R6338:Agrn	UTSW	4	156170585	missense	probably benign	0.17
R6351:Agrn	UTSW	4	156179434	missense	probably benign	0.00
R6437:Agrn	UTSW	4	156176778	missense	probably damaging	0.96
R6490:Agrn	UTSW	4	156167362	nonsense	probably null
R6909:Agrn	UTSW	4	156177007	missense	possibly damaging	0.90
R7110:Agrn	UTSW	4	156178875	missense	possibly damaging	0.88
R7123:Agrn	UTSW	4	156172840	missense	probably benign
R7163:Agrn	UTSW	4	156178509	missense	probably damaging	1.00
R7180:Agrn	UTSW	4	156171839	missense	probably benign	0.00
R7251:Agrn	UTSW	4	156174606	missense	probably damaging	1.00
R7289:Agrn	UTSW	4	156178932	missense	probably damaging	1.00
R7335:Agrn	UTSW	4	156176532	missense	probably damaging	1.00
R7336:Agrn	UTSW	4	156174914	nonsense	probably null
R7406:Agrn	UTSW	4	156172301	missense	possibly damaging	0.93
R7460:Agrn	UTSW	4	156174424	missense	probably damaging	0.98
R7531:Agrn	UTSW	4	156169804	missense	probably damaging	1.00
R7585:Agrn	UTSW	4	156170674	missense	probably benign	0.08
R7646:Agrn	UTSW	4	156195354	missense	probably damaging	0.99
R7652:Agrn	UTSW	4	156169218	critical splice donor site	probably null
R7714:Agrn	UTSW	4	156195397	missense	probably damaging	1.00
R7751:Agrn	UTSW	4	156176429	missense	probably damaging	1.00
R7852:Agrn	UTSW	4	156169057	missense	probably benign	0.01
R7927:Agrn	UTSW	4	156172809	missense	probably damaging	0.99
R8056:Agrn	UTSW	4	156170411	missense	probably benign
R8061:Agrn	UTSW	4	156178954	missense	probably damaging	1.00
R8158:Agrn	UTSW	4	156173889	missense	probably benign
R8159:Agrn	UTSW	4	156172368	missense	probably benign	0.27
R8325:Agrn	UTSW	4	156173662	missense	probably benign	0.01
R8338:Agrn	UTSW	4	156168561	missense	probably benign	0.01
R8739:Agrn	UTSW	4	156172588	missense	probably benign
R8956:Agrn	UTSW	4	156166538	missense	probably damaging	0.99
R9094:Agrn	UTSW	4	156168807	missense	probably benign	0.01
R9112:Agrn	UTSW	4	156177057	missense	probably damaging	1.00
R9384:Agrn	UTSW	4	156172649	missense	probably damaging	1.00
R9472:Agrn	UTSW	4	156170384	missense
R9619:Agrn	UTSW	4	156174033	missense	probably benign	0.00
R9629:Agrn	UTSW	4	156172637	nonsense	probably null
R9732:Agrn	UTSW	4	156173989	missense	probably benign	0.13
R9749:Agrn	UTSW	4	156173657	missense	probably benign	0.02
R9757:Agrn	UTSW	4	156176778	missense	probably benign	0.03
R9792:Agrn	UTSW	4	156176672	missense	probably benign	0.09
R9793:Agrn	UTSW	4	156176672	missense	probably benign	0.09
Z1177:Agrn	UTSW	4	156171544	nonsense	probably null
Z1177:Agrn	UTSW	4	156179576	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AATGGCCTCAGGTGAGATCTCC -3'
(R):5'- TGACTTCAGCAAGCTGGCTC -3'

Sequencing Primer
(F):5'- TCAGGTGAGATCTCCAGGCC -3'
(R):5'- CATCCAGCTGGTACGGAGATG -3'

Posted On

2020-01-23