Mutagenetix > Incidental Mutation

Incidental Mutation 'R1647:Pygl'

173972

Institutional Source

Beutler Lab

Gene Symbol

Pygl

Ensembl Gene

ENSMUSG00000021069

Gene Name

liver glycogen phosphorylase

Synonyms

MMRRC Submission

039683-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.305) question?

Stock #

R1647 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70190811-70231488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70197010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 553 (I553F)

Ref Sequence

ENSEMBL: ENSMUSP00000125585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]

AlphaFold

Q9ET01

Predicted Effect

probably benign
Transcript: ENSMUST00000071250
AA Change: I644F

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: I644F

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	113	829	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161083
AA Change: I553F

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: I553F

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	21	739	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162613

Meta Mutation Damage Score

0.8505

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	A	G	4: 109,505,571	S184P	probably damaging	Het
Adgb	A	G	10: 10,395,371	F817L	probably damaging	Het
Anxa10	T	C	8: 62,092,584	D38G	probably damaging	Het
Atp8b2	G	A	3: 89,941,784	A1081V	probably benign	Het
Baz1a	G	A	12: 54,975,198	R100C	probably damaging	Het
Ceacam18	A	C	7: 43,639,265	T147P	possibly damaging	Het
Cep170b	C	T	12: 112,736,372	T423I	probably damaging	Het
Chd6	A	G	2: 161,042,058	L89S	probably damaging	Het
Chrm3	A	T	13: 9,878,425	W192R	probably damaging	Het
Cnn1	C	A	9: 22,107,854	A202E	probably damaging	Het
Dcaf7	T	A	11: 106,051,802	F192I	probably damaging	Het
Eif2b5	T	C	16: 20,502,585	V296A	possibly damaging	Het
Entpd7	A	G	19: 43,721,745		probably benign	Het
Esr1	A	G	10: 5,001,260	E546G	possibly damaging	Het
Etaa1	C	A	11: 17,946,492	G542C	probably damaging	Het
Exosc8	A	T	3: 54,734,101		probably null	Het
Fras1	T	A	5: 96,726,613		probably null	Het
G930045G22Rik	T	C	6: 50,846,718		noncoding transcript	Het
Gm22697+Rbm27	AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC	AGGTCCCGGCCCAGGCCC	18: 42,301,883		probably benign	Het
Gm5615	A	G	9: 36,534,440	S72P	possibly damaging	Het
Gpr155	T	C	2: 73,364,164		probably null	Het
Has1	A	G	17: 17,849,985	Y225H	probably damaging	Het
Hk3	A	G	13: 55,014,461	F110S	probably damaging	Het
Iars	A	G	13: 49,723,002	K848E	possibly damaging	Het
Il22ra1	C	A	4: 135,750,460	H281N	probably damaging	Het
Inpp4b	G	T	8: 81,856,774		probably benign	Het
Itga11	A	G	9: 62,760,370	N662D	probably benign	Het
Kif20b	A	T	19: 34,936,790	T355S	possibly damaging	Het
Kif21a	T	C	15: 90,994,367	T237A	probably damaging	Het
Klc1	T	C	12: 111,776,887	L216P	probably damaging	Het
Krt84	G	A	15: 101,525,963	S523F	possibly damaging	Het
Lama3	A	G	18: 12,532,199	D2330G	possibly damaging	Het
Lamb2	G	A	9: 108,481,423		probably null	Het
Limch1	T	A	5: 66,999,256	S511R	probably damaging	Het
Lnx2	C	A	5: 147,027,342	V468L	probably benign	Het
Lrriq1	A	T	10: 103,170,648	C1205*	probably null	Het
Lsm4	A	G	8: 70,677,806	Y25C	probably damaging	Het
Macc1	T	C	12: 119,446,421	M308T	probably benign	Het
Miip	T	C	4: 147,865,234	S174G	probably benign	Het
Mroh9	T	G	1: 163,046,056	E510A	probably damaging	Het
Msh2	C	T	17: 87,672,636	A14V	probably benign	Het
Nbea	T	A	3: 55,630,229	I2828F	probably damaging	Het
Nkx2-3	A	T	19: 43,614,456	Q167L	probably damaging	Het
Nup160	T	C	2: 90,710,088	Y854H	probably damaging	Het
Olfr1436	T	A	19: 12,298,659	I158L	probably benign	Het
Olfr519	A	G	7: 108,893,765	I214T	probably damaging	Het
Olfr642	A	G	7: 104,050,169	Y62H	probably damaging	Het
Phldb1	G	A	9: 44,715,433	P572S	probably damaging	Het
Plcb2	A	T	2: 118,723,780	M64K	possibly damaging	Het
Prr12	T	A	7: 45,034,192	N1683Y	probably benign	Het
Prrg4	C	A	2: 104,832,743	A173S	probably benign	Het
Rasd1	T	C	11: 59,964,094	M187V	probably benign	Het
Rasgrf1	A	G	9: 89,953,920	I234V	probably benign	Het
Rps6ka4	C	A	19: 6,839,362	V118L	probably benign	Het
Sbspon	C	A	1: 15,883,759	R99L	probably damaging	Het
Sdhaf3	T	C	6: 6,956,126	Y34H	probably damaging	Het
Setd2	A	G	9: 110,549,864	S632G	probably benign	Het
Shc2	T	A	10: 79,626,111	M367L	probably benign	Het
Slc26a5	T	A	5: 21,813,976	K590*	probably null	Het
Slc39a12	T	C	2: 14,451,992	V597A	probably benign	Het
Slc45a3	G	A	1: 131,977,524	G81D	probably damaging	Het
Spata2l	T	C	8: 123,233,302	N416S	probably benign	Het
Tdrd6	A	C	17: 43,627,109	V1016G	possibly damaging	Het
Tet2	A	G	3: 133,485,880	V931A	probably benign	Het
Tmem190	A	G	7: 4,784,121	D108G	probably damaging	Het
Trip11	T	A	12: 101,884,392	K853*	probably null	Het
Vmn2r111	A	T	17: 22,569,061	D436E	probably benign	Het
Zfp704	A	T	3: 9,471,039	S140R	probably damaging	Het

Other mutations in Pygl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pygl	APN	12	70191092	missense	probably damaging	1.00
IGL00903:Pygl	APN	12	70207742	missense	probably damaging	1.00
IGL01965:Pygl	APN	12	70191114	missense	probably benign	0.00
IGL02347:Pygl	APN	12	70201892	missense	probably benign	0.14
IGL02403:Pygl	APN	12	70194258	missense	probably benign
IGL02501:Pygl	APN	12	70191134	missense	probably benign	0.05
IGL02727:Pygl	APN	12	70207668	splice site	probably null
IGL03125:Pygl	APN	12	70197482	missense	probably damaging	1.00
IGL03158:Pygl	APN	12	70195675	missense	probably damaging	1.00
IGL03202:Pygl	APN	12	70199646	missense	probably benign
IGL03368:Pygl	APN	12	70191152	missense	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0524:Pygl	UTSW	12	70207724	missense	probably damaging	1.00
R0883:Pygl	UTSW	12	70206404	missense	probably damaging	0.97
R0894:Pygl	UTSW	12	70194374	splice site	probably benign
R0905:Pygl	UTSW	12	70211017	splice site	probably benign
R1494:Pygl	UTSW	12	70199730	missense	probably damaging	0.98
R1621:Pygl	UTSW	12	70191092	missense	probably damaging	1.00
R3082:Pygl	UTSW	12	70197529	missense	probably damaging	1.00
R3845:Pygl	UTSW	12	70198443	missense	probably benign	0.12
R3876:Pygl	UTSW	12	70201339	missense	probably damaging	1.00
R4358:Pygl	UTSW	12	70195690	missense	probably damaging	1.00
R4614:Pygl	UTSW	12	70210979	splice site	probably null
R4707:Pygl	UTSW	12	70207758	missense	possibly damaging	0.69
R4908:Pygl	UTSW	12	70197033	missense	probably null
R4940:Pygl	UTSW	12	70206381	missense	probably damaging	1.00
R5077:Pygl	UTSW	12	70201892	missense	probably benign	0.14
R5186:Pygl	UTSW	12	70201344	missense	probably damaging	1.00
R5726:Pygl	UTSW	12	70191142	nonsense	probably null
R5953:Pygl	UTSW	12	70219627	missense	probably damaging	1.00
R5957:Pygl	UTSW	12	70199720	missense	probably damaging	0.99
R6020:Pygl	UTSW	12	70216654	missense	probably damaging	1.00
R6024:Pygl	UTSW	12	70197067	missense	probably benign	0.09
R7050:Pygl	UTSW	12	70219622	missense	probably damaging	1.00
R7159:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R7194:Pygl	UTSW	12	70194320	missense	probably benign
R7283:Pygl	UTSW	12	70216568	missense	possibly damaging	0.92
R7360:Pygl	UTSW	12	70227532	missense	probably benign	0.11
R7446:Pygl	UTSW	12	70197010	missense	probably benign
R7637:Pygl	UTSW	12	70197795	splice site	probably null
R7886:Pygl	UTSW	12	70206356	splice site	probably null
R8054:Pygl	UTSW	12	70227339	critical splice donor site	probably null
R8693:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R8753:Pygl	UTSW	12	70195626	missense	probably damaging	1.00
R8803:Pygl	UTSW	12	70195616	missense	probably damaging	1.00
R8842:Pygl	UTSW	12	70227594	intron	probably benign
R9192:Pygl	UTSW	12	70197048	missense	probably damaging	0.99
R9221:Pygl	UTSW	12	70195627	missense	probably damaging	1.00
R9437:Pygl	UTSW	12	70200151	missense	probably damaging	1.00
R9750:Pygl	UTSW	12	70198529	missense	possibly damaging	0.68
Z1176:Pygl	UTSW	12	70222874	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- ACTTGGGCTGGCAACTGAAGAC -3'
(R):5'- GCTTGCTTTCTTCATCGCTGGGAAC -3'

Sequencing Primer
(F):5'- CATGTGACACTGATCCCATAGG -3'
(R):5'- GGGAACCTTCTCTCCACAC -3'

Posted On

2014-04-24