Incidental Mutation 'R7882:Vmn2r88'
ID628749
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Namevomeronasal 2, receptor 88
SynonymsV2r3, V2r13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7882 (G1)
Quality Score40.0075
Status Validated
Chromosome14
Chromosomal Location51410819-51419527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 51413046 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 72 (A72G)
Ref Sequence ENSEMBL: ENSMUSP00000154310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
Predicted Effect probably benign
Transcript: ENSMUST00000022438
AA Change: A72G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: A72G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: A72G

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163019
AA Change: A47G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: A47G

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228139
AA Change: A72G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm C A 3: 153,938,613 E110* probably null Het
Adad1 G T 3: 37,079,802 V289F probably damaging Het
Adgra2 A G 8: 27,117,412 D717G probably benign Het
Arid3b T C 9: 57,796,497 I389M possibly damaging Het
Axdnd1 A G 1: 156,397,453 V47A Het
Cachd1 T A 4: 100,967,047 L562M probably benign Het
Cadm2 A T 16: 66,731,471 I326N probably benign Het
Ccpg1 T C 9: 73,015,505 F799S probably damaging Het
Ces1c T C 8: 93,106,603 I411M probably benign Het
Cgn T G 3: 94,762,634 K1066N probably damaging Het
Cntn4 A G 6: 106,353,723 I101V probably benign Het
Cntrl A G 2: 35,170,580 E1928G probably benign Het
Cxcl12 A G 6: 117,171,503 Y28C probably damaging Het
Cyp2r1 A T 7: 114,554,589 probably null Het
D430041D05Rik C T 2: 104,257,629 W334* probably null Het
Dsp G A 13: 38,184,018 R671Q possibly damaging Het
Fancm A G 12: 65,126,794 K1960R probably benign Het
Fgd5 T A 6: 92,068,478 Y1331N probably damaging Het
Ina G A 19: 47,015,661 E303K Het
Kctd3 C A 1: 188,983,046 V369F possibly damaging Het
Kif14 T C 1: 136,471,576 probably null Het
Kif14 T C 1: 136,516,025 V1312A probably benign Het
Krt84 T C 15: 101,528,391 I403V probably benign Het
Krtap9-1 A C 11: 99,873,530 T31P unknown Het
Lyrm9 A T 11: 78,838,141 I60F probably damaging Het
Mast1 A G 8: 84,913,318 probably null Het
Mmp28 T C 11: 83,443,926 D334G probably damaging Het
Nr1h5 T C 3: 102,949,615 T194A possibly damaging Het
Nrf1 A G 6: 30,090,300 I85M probably benign Het
Nrp2 C T 1: 62,783,521 R758C probably damaging Het
Olfr1471 A T 19: 13,445,587 T192S probably benign Het
Pcdhga4 A G 18: 37,686,628 D410G probably damaging Het
Pld1 T C 3: 28,045,009 V275A probably damaging Het
Plxnc1 A T 10: 94,843,836 F895I probably benign Het
Polr2a A G 11: 69,736,174 I1486T possibly damaging Het
Ptprz1 A G 6: 23,002,257 M1449V probably benign Het
Rspo4 C A 2: 151,869,826 T156N probably damaging Het
Sacs A G 14: 61,207,071 I2189V probably benign Het
Stat5b A C 11: 100,783,775 F711V possibly damaging Het
Stk11ip C A 1: 75,529,464 Q543K probably benign Het
Tarbp1 G A 8: 126,456,493 T529M probably damaging Het
Thada A T 17: 84,429,196 C886S possibly damaging Het
Tmem19 A G 10: 115,343,703 F296S probably benign Het
Tnfsf13b A G 8: 10,007,078 N79S not run Het
Vdac3 C A 8: 22,579,057 G214C probably damaging Het
Vmn2r18 A C 5: 151,561,864 F722V probably damaging Het
Vmn2r45 A G 7: 8,483,410 L293S possibly damaging Het
Xpot A G 10: 121,619,091 probably null Het
Zfp526 G A 7: 25,221,435 probably benign Het
Zfp532 A G 18: 65,623,490 T165A probably benign Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51413125 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413060 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413256 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51416802 missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51417980 missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51414154 missense probably benign
IGL02483:Vmn2r88 APN 14 51414154 missense probably benign
IGL03241:Vmn2r88 APN 14 51418373 missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51418700 missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51414140 missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51414502 missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51418209 missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51414108 missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51418550 missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51416787 missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51418572 missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51413030 splice site probably benign
R1911:Vmn2r88 UTSW 14 51418214 missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51418194 missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51413208 missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51413807 missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51414004 missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51418689 missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51413934 missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51418632 missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51413978 missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51413190 missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51415426 missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51413289 nonsense probably null
R4397:Vmn2r88 UTSW 14 51417978 missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51418081 missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51418074 missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51418793 missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51418155 missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51413334 missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51413339 missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51413245 missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51413181 missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51411146 missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51413910 missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51418572 missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51418149 nonsense probably null
R6103:Vmn2r88 UTSW 14 51415369 missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51414338 missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51413969 missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51418643 missense
R7104:Vmn2r88 UTSW 14 51413796 missense
R7265:Vmn2r88 UTSW 14 51418319 missense
R7316:Vmn2r88 UTSW 14 51414255 missense
R7552:Vmn2r88 UTSW 14 51410858 splice site probably null
R7611:Vmn2r88 UTSW 14 51413997 missense
R7667:Vmn2r88 UTSW 14 51417989 missense
R7682:Vmn2r88 UTSW 14 51418449 missense
R7755:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51418703 missense
R7957:Vmn2r88 UTSW 14 51413132 missense
R7998:Vmn2r88 UTSW 14 51414108 missense
R8142:Vmn2r88 UTSW 14 51414107 missense
R8186:Vmn2r88 UTSW 14 51418700 missense
R8348:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51413073 missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51414066 missense
R8859:Vmn2r88 UTSW 14 51418806 missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51411136 missense
R8936:Vmn2r88 UTSW 14 51418526 missense possibly damaging 0.88
V5622:Vmn2r88 UTSW 14 51413127 missense probably benign
X0024:Vmn2r88 UTSW 14 51413832 missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51416802 missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51418046 frame shift probably null
Z1177:Vmn2r88 UTSW 14 51418187 missense
Z1190:Vmn2r88 UTSW 14 51413201 missense
Predicted Primers PCR Primer
(F):5'- GATCCCTGTGCTCAGACAAC -3'
(R):5'- GTCCTGTAAGACCTATGGCAC -3'

Sequencing Primer
(F):5'- TGTGCTCAGACAACACTTAAAGG -3'
(R):5'- TGGCACATGAATCATCTAAATAACAG -3'
Posted On2020-06-18