Incidental Mutation 'R8132:Ifna15'
ID 632060
Institutional Source Beutler Lab
Gene Symbol Ifna15
Ensembl Gene ENSMUSG00000096011
Gene Name interferon alpha 15
Synonyms Ifnaa, Gm12597
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R8132 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 88557673-88558245 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88557683 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 188 (E188G)
Ref Sequence ENSEMBL: ENSMUSP00000099873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102809]
AlphaFold Q61718
Predicted Effect possibly damaging
Transcript: ENSMUST00000102809
AA Change: E188G

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099873
Gene: ENSMUSG00000096011
AA Change: E188G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IFabd 58 175 2.97e-68 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Ifna15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Ifna15 APN 4 88557807 missense probably damaging 1.00
IGL01757:Ifna15 APN 4 88558085 missense possibly damaging 0.79
IGL01824:Ifna15 APN 4 88557783 missense probably benign 0.00
R3853:Ifna15 UTSW 4 88557809 missense probably damaging 1.00
R4356:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R4357:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R4358:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R4359:Ifna15 UTSW 4 88557842 missense probably benign 0.09
R5038:Ifna15 UTSW 4 88558029 missense probably benign 0.03
R5372:Ifna15 UTSW 4 88558101 missense probably damaging 0.97
R6036:Ifna15 UTSW 4 88558073 missense possibly damaging 0.65
R6036:Ifna15 UTSW 4 88558073 missense possibly damaging 0.65
R7347:Ifna15 UTSW 4 88557983 missense probably damaging 1.00
R8097:Ifna15 UTSW 4 88557701 missense probably benign 0.01
R8824:Ifna15 UTSW 4 88557761 missense probably damaging 1.00
R9349:Ifna15 UTSW 4 88558046 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTGCAGGATTGAGAACAAATACC -3'
(R):5'- CCTCAAAGCCTGTGTGATGC -3'

Sequencing Primer
(F):5'- GGAACATCTAGGCTGGTT -3'
(R):5'- GGGGTGCAGGAACCTCC -3'
Posted On 2020-06-30