Incidental Mutation 'R0724:Sost'
ID 63825
Institutional Source Beutler Lab
Gene Symbol Sost
Ensembl Gene ENSMUSG00000001494
Gene Name sclerostin
Synonyms 5430411E23Rik
MMRRC Submission 038906-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R0724 (G1)
Quality Score 113
Status Validated
Chromosome 11
Chromosomal Location 101962458-101967015 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 101966918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 19 (C19Y)
Ref Sequence ENSEMBL: ENSMUSP00000001534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001534] [ENSMUST00000003612] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000151678]
AlphaFold Q99P68
Predicted Effect probably benign
Transcript: ENSMUST00000001534
AA Change: C19Y

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000001534
Gene: ENSMUSG00000001494
AA Change: C19Y

DomainStartEndE-ValueType
Pfam:Sclerostin 1 208 8e-98 PFAM
Pfam:DAN 51 168 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003612
SMART Domains Protein: ENSMUSP00000003612
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107172
SMART Domains Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107173
SMART Domains Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 54 201 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151678
SMART Domains Protein: ENSMUSP00000135384
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 3 108 6.99e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176599
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sclerostin is a secreted glycoprotein with a C-terminal cysteine knot-like (CTCK) domain and sequence similarity to the DAN (differential screening-selected gene aberrative in neuroblastoma) family of bone morphogenetic protein (BMP) antagonists. Loss-of-function mutations in this gene are associated with an autosomal-recessive disorder, sclerosteosis, which causes progressive bone overgrowth. A deletion downstream of this gene, which causes reduced sclerostin expression, is associated with a milder form of the disorder called van Buchem disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase in trabecular and cortical bone volume, mineral density, and formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Sost
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Sost APN 11 101966879 missense probably damaging 1.00
IGL02487:Sost APN 11 101966807 missense possibly damaging 0.64
IGL02967:Sost APN 11 101964258 missense possibly damaging 0.50
R1873:Sost UTSW 11 101964243 missense probably damaging 1.00
R2182:Sost UTSW 11 101963850 missense probably damaging 1.00
R3429:Sost UTSW 11 101964039 missense probably damaging 1.00
R4428:Sost UTSW 11 101966844 missense probably damaging 0.97
R4430:Sost UTSW 11 101966844 missense probably damaging 0.97
R4464:Sost UTSW 11 101966844 missense probably damaging 0.97
R4537:Sost UTSW 11 101966844 missense probably damaging 0.97
R4539:Sost UTSW 11 101966844 missense probably damaging 0.97
R4540:Sost UTSW 11 101966844 missense probably damaging 0.97
R4541:Sost UTSW 11 101966844 missense probably damaging 0.97
R4542:Sost UTSW 11 101966844 missense probably damaging 0.97
R4710:Sost UTSW 11 101966844 missense probably damaging 0.97
R5125:Sost UTSW 11 101963941 missense probably damaging 1.00
R7297:Sost UTSW 11 101964103 missense probably damaging 1.00
R7779:Sost UTSW 11 101966849 missense possibly damaging 0.75
R9617:Sost UTSW 11 101964066 missense possibly damaging 0.85
RF013:Sost UTSW 11 101964132 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCTGTGTCCTCATCCTTAGGAG -3'
(R):5'- TGCCAGCAGCAATTTGGAAGTTTAC -3'

Sequencing Primer
(F):5'- GAGGAGATTCTCTGGACCATCATAC -3'
(R):5'- GAAGTTTACTGAGCTTGAGAAGTC -3'
Posted On 2013-07-30