Mutagenetix > Incidental Mutations

Incidental Mutation 'R0724:Atp1a1'

262002

Institutional Source

Beutler Lab

Gene Symbol

Atp1a1

Ensembl Gene

ENSMUSG00000033161

Gene Name

ATPase, Na+/K+ transporting, alpha 1 polypeptide

Synonyms

Atpa-1

MMRRC Submission

038906-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0724 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

101576219-101604684 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101592439 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 109 (I109N)

Ref Sequence

ENSEMBL: ENSMUSP00000039657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036493]

AlphaFold

Q8VDN2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036493
AA Change: I109N

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: I109N

Domain	Start	End	E-Value	Type
low complexity region	21	28	N/A	INTRINSIC
Cation_ATPase_N	42	116	5e-20	SMART
Pfam:E1-E2_ATPase	134	365	1.6e-59	PFAM
Pfam:Hydrolase	370	729	2.7e-19	PFAM
Pfam:HAD	373	726	1.3e-18	PFAM
Pfam:Cation_ATPase	426	521	2.2e-25	PFAM
Pfam:Cation_ATPase_C	799	1008	1.2e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136340

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200347

Meta Mutation Damage Score

0.9599

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	A	G	5: 145,044,763	E136G	probably benign	Het
Adgre4	T	A	17: 55,852,281	S655R	probably benign	Het
Ak7	T	A	12: 105,710,254	V71E	probably benign	Het
Ank2	C	T	3: 126,962,337	R1077H	probably damaging	Het
Anxa3	A	G	5: 96,828,748	T198A	possibly damaging	Het
Camta1	A	G	4: 151,077,892	I119T	probably damaging	Het
Carm1	A	G	9: 21,587,374	Y504C	probably damaging	Het
Casp1	C	T	9: 5,303,077	P177L	probably benign	Het
Ccdc122	C	A	14: 77,092,077		probably benign	Het
Ces1a	A	G	8: 93,039,513	S158P	probably damaging	Het
Ces3a	T	A	8: 105,050,195	D103E	possibly damaging	Het
Clstn1	A	C	4: 149,643,624	D583A	possibly damaging	Het
Corin	A	G	5: 72,332,795		probably benign	Het
Cryba1	T	C	11: 77,719,457	D144G	probably damaging	Het
Cwf19l2	G	T	9: 3,421,377		probably null	Het
Dis3l	T	C	9: 64,307,126	T1027A	possibly damaging	Het
Dopey2	A	G	16: 93,762,325	E653G	probably benign	Het
Dst	A	G	1: 34,188,677	I1459V	probably benign	Het
Dyrk3	T	C	1: 131,130,140	T64A	probably benign	Het
Emp2	C	T	16: 10,284,615	C111Y	probably benign	Het
Enam	A	G	5: 88,501,994	Y454C	probably damaging	Het
Fbn1	A	T	2: 125,352,064	C1328S	probably benign	Het
Gata3	T	C	2: 9,874,575	T197A	probably benign	Het
Gm1043	A	G	5: 37,187,229	T212A	probably damaging	Het
Gm15448	T	C	7: 3,816,872	N564S	possibly damaging	Het
H2-Eb1	T	C	17: 34,315,032		probably benign	Het
Hand1	T	C	11: 57,831,680	H36R	probably damaging	Het
Hmgcs2	C	A	3: 98,297,001	Y239*	probably null	Het
Hoxc12	A	G	15: 102,937,055	Y68C	probably damaging	Het
Inpp5a	A	G	7: 139,516,663	I143V	probably benign	Het
Klhdc2	C	A	12: 69,297,048	F18L	probably benign	Het
Kpnb1	T	C	11: 97,178,304	Y251C	probably damaging	Het
Lrch4	A	T	5: 137,637,308	N315I	probably damaging	Het
Map3k10	A	C	7: 27,668,355	V286G	probably damaging	Het
Myo7b	G	A	18: 32,005,549		probably benign	Het
Nlrp2	G	T	7: 5,319,222	L809I	probably damaging	Het
Oacyl	T	C	18: 65,737,825		probably benign	Het
Olfr735	A	G	14: 50,345,917	V175A	possibly damaging	Het
Paxbp1	T	A	16: 91,036,536	D270V	probably damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Plcb3	G	A	19: 6,963,392	R359C	probably damaging	Het
Plcxd3	G	A	15: 4,516,868	S118N	probably damaging	Het
Ptpn14	T	C	1: 189,850,947	S664P	possibly damaging	Het
Sirt1	T	C	10: 63,323,973	I443V	possibly damaging	Het
Slc7a8	G	A	14: 54,735,186		probably benign	Het
Smim14	A	G	5: 65,453,339		probably benign	Het
Sost	C	T	11: 101,966,918	C19Y	probably benign	Het
Tcaf1	G	T	6: 42,675,367	A727E	probably damaging	Het
Thoc1	T	C	18: 9,963,829	L144P	probably damaging	Het
Tmem132b	A	T	5: 125,783,421	T577S	possibly damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tshr	T	C	12: 91,538,286	F666S	probably damaging	Het
Wdr1	A	G	5: 38,540,862	V192A	possibly damaging	Het
Zfp697	T	C	3: 98,428,166	W416R	probably damaging	Het

Other mutations in Atp1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01396:Atp1a1	APN	3	101591453	missense	probably damaging	1.00
IGL01700:Atp1a1	APN	3	101594258	missense	possibly damaging	0.95
IGL01836:Atp1a1	APN	3	101591414	missense	probably damaging	1.00
IGL01863:Atp1a1	APN	3	101591889	nonsense	probably null
IGL02021:Atp1a1	APN	3	101594208	missense	probably benign	0.02
IGL02078:Atp1a1	APN	3	101591863	missense	probably damaging	1.00
IGL02873:Atp1a1	APN	3	101576578	missense	probably benign	0.16
IGL02934:Atp1a1	APN	3	101576992	nonsense	probably null
IGL03068:Atp1a1	APN	3	101583859	missense	probably benign	0.26
PIT4453001:Atp1a1	UTSW	3	101581179	missense	probably benign	0.01
R0009:Atp1a1	UTSW	3	101579835	missense	possibly damaging	0.67
R0506:Atp1a1	UTSW	3	101589812	missense	probably damaging	0.96
R0826:Atp1a1	UTSW	3	101584853	missense	probably damaging	0.99
R1457:Atp1a1	UTSW	3	101590466	missense	probably damaging	1.00
R1732:Atp1a1	UTSW	3	101584799	missense	probably damaging	1.00
R1843:Atp1a1	UTSW	3	101582017	missense	probably benign	0.43
R2172:Atp1a1	UTSW	3	101590548	missense	probably benign
R3770:Atp1a1	UTSW	3	101581194	missense	probably benign	0.17
R3905:Atp1a1	UTSW	3	101590612	missense	probably benign	0.00
R4602:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4611:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4715:Atp1a1	UTSW	3	101591806	missense	possibly damaging	0.90
R4777:Atp1a1	UTSW	3	101594996	critical splice donor site	probably null
R4795:Atp1a1	UTSW	3	101583775	missense	probably benign	0.15
R5030:Atp1a1	UTSW	3	101579817	missense	probably benign	0.22
R5066:Atp1a1	UTSW	3	101582104	missense	probably damaging	0.98
R5165:Atp1a1	UTSW	3	101581789	missense	probably benign	0.01
R5297:Atp1a1	UTSW	3	101591127	missense	possibly damaging	0.82
R5307:Atp1a1	UTSW	3	101589964	missense	probably damaging	1.00
R5379:Atp1a1	UTSW	3	101582095	missense	probably benign	0.01
R5495:Atp1a1	UTSW	3	101591425	missense	probably benign	0.01
R5946:Atp1a1	UTSW	3	101589774	missense	probably benign	0.12
R6125:Atp1a1	UTSW	3	101590707	missense	probably damaging	1.00
R6789:Atp1a1	UTSW	3	101586298	missense	possibly damaging	0.71
R7339:Atp1a1	UTSW	3	101589872	missense	probably benign	0.44
R7552:Atp1a1	UTSW	3	101582121	nonsense	probably null
R7825:Atp1a1	UTSW	3	101586169	missense	probably benign	0.00
R8098:Atp1a1	UTSW	3	101582049	missense	probably damaging	0.97
R8175:Atp1a1	UTSW	3	101584854	missense	possibly damaging	0.79
R8281:Atp1a1	UTSW	3	101579624	missense	probably benign	0.12
R8403:Atp1a1	UTSW	3	101586904	missense	probably damaging	1.00
R8435:Atp1a1	UTSW	3	101582762	missense	probably benign
R8461:Atp1a1	UTSW	3	101589089	missense	probably benign	0.01
R8772:Atp1a1	UTSW	3	101579808	missense	probably benign
R8782:Atp1a1	UTSW	3	101594217	missense	possibly damaging	0.63
R8919:Atp1a1	UTSW	3	101591231	missense	probably damaging	1.00
R9066:Atp1a1	UTSW	3	101582022	missense	probably damaging	1.00
R9227:Atp1a1	UTSW	3	101592434	missense	probably damaging	1.00
X0019:Atp1a1	UTSW	3	101594213	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGTCCAGCACACCTAAGTGCAGAG -3'
(R):5'- CTCCTCAGGGATTAACACCTGCAAG -3'

Sequencing Primer
(F):5'- ggcagagccaggcagag -3'
(R):5'- TTAACACCTGCAAGGGCCG -3'

Posted On

2015-02-04