Incidental Mutation 'R0724:Tnfrsf21'
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Nametumor necrosis factor receptor superfamily, member 21
SynonymsDR6, TR7, Death receptor 6
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R0724 (G1)
Quality Score81
Status Validated
Chromosomal Location43016555-43089188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43038213 bp
Amino Acid Change Histidine to Tyrosine at position 239 (H239Y)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
Predicted Effect probably benign
Transcript: ENSMUST00000024708
AA Change: H239Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: H239Y

TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0088:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0091:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0103:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0206:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0240:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0363:Tnfrsf21 UTSW 17 43037877 missense probably benign 0.01
R0456:Tnfrsf21 UTSW 17 43038091 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4438:Tnfrsf21 UTSW 17 43087842 missense possibly damaging 0.49
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R4811:Tnfrsf21 UTSW 17 43037730 missense probably benign 0.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6392:Tnfrsf21 UTSW 17 43017088 missense probably benign 0.00
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
R7643:Tnfrsf21 UTSW 17 43037916 missense probably benign 0.00
R7937:Tnfrsf21 UTSW 17 43037925 missense probably benign 0.01
R8098:Tnfrsf21 UTSW 17 43039899 missense probably benign
R8495:Tnfrsf21 UTSW 17 43038237 missense probably benign
R8865:Tnfrsf21 UTSW 17 43085481 missense probably damaging 1.00
R8991:Tnfrsf21 UTSW 17 43085408 missense probably benign 0.03
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acaactaaaatcactcaactcactc -3'
Posted On2013-07-30