Incidental Mutation 'R7970:Tnks'
ID 650559
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Name tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7970 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 34826460-34965690 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 34855926 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
AlphaFold Q6PFX9
PDB Structure Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000033929
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,033,160 N312S probably benign Het
Acnat1 A G 4: 49,449,266 F167L probably damaging Het
Acsbg2 A G 17: 56,849,728 Y437H probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Anapc2 T C 2: 25,273,287 S179P possibly damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Arrdc4 G A 7: 68,741,072 P307S probably damaging Het
B3gnt2 T C 11: 22,836,255 Y311C probably damaging Het
Brf1 T C 12: 112,964,200 D453G probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dst G T 1: 34,182,747 C2544F possibly damaging Het
Efhc1 C T 1: 20,951,795 T21M probably benign Het
Efs A G 14: 54,920,503 probably null Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam171a2 A T 11: 102,437,866 V689E possibly damaging Het
Fam184a T C 10: 53,699,325 T63A probably damaging Het
Fam186a T C 15: 99,933,586 D2897G unknown Het
Fbxw11 T G 11: 32,722,101 S224A probably benign Het
Flnc G T 6: 29,447,526 E1109D possibly damaging Het
Foxn4 A G 5: 114,263,007 probably null Het
Gm19410 A G 8: 35,815,647 E2009G probably benign Het
Gm9958 A G 5: 90,367,709 probably benign Het
Gprin3 C T 6: 59,353,165 R719Q possibly damaging Het
Grip2 A T 6: 91,786,532 I147N probably benign Het
H2-DMb2 A G 17: 34,150,598 R239G probably benign Het
Hydin A C 8: 110,309,091 D138A probably damaging Het
Ikbkap A T 4: 56,771,466 Y944N probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lgr6 A G 1: 134,993,985 I484T probably benign Het
Mkrn2 T A 6: 115,617,308 C327S probably damaging Het
Mnt C T 11: 74,842,210 A288V probably damaging Het
Nckap5 T A 1: 126,025,021 K1265* probably null Het
Ncoa3 A T 2: 166,051,357 H194L probably benign Het
Ogn A T 13: 49,609,266 H28L probably benign Het
Olfr1160 A T 2: 88,005,825 F309I probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr680-ps1 C A 7: 105,091,349 V97L probably benign Het
Pclo T C 5: 14,714,478 S1037P Het
Phlpp1 T A 1: 106,173,285 Y428N probably damaging Het
Ptpre A G 7: 135,678,319 T591A possibly damaging Het
Rtn1 A T 12: 72,308,874 D99E probably benign Het
Scn7a A T 2: 66,675,829 I1572N probably damaging Het
Sema3a T A 5: 13,599,407 M708K possibly damaging Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Slc9a2 T C 1: 40,726,214 Y255H probably damaging Het
Spock3 T C 8: 63,345,715 F254L probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
St6galnac2 T C 11: 116,690,343 D51G probably benign Het
Stard13 T A 5: 151,063,261 K261N possibly damaging Het
Tlk1 T C 2: 70,752,300 R162G possibly damaging Het
Tlr2 T C 3: 83,837,894 D294G probably benign Het
Trip4 A G 9: 65,839,016 S533P probably damaging Het
Ttc3 T A 16: 94,457,364 W1674R probably damaging Het
Vmn2r114 T C 17: 23,311,212 N74D probably benign Het
Zcchc11 G A 4: 108,486,454 S221N probably benign Het
Zdbf2 T C 1: 63,304,171 Y570H possibly damaging Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R1938:Tnks UTSW 8 34838530 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3913:Tnks UTSW 8 34873074 missense probably damaging 0.99
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R4760:Tnks UTSW 8 34851783 missense probably benign 0.38
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R6991:Tnks UTSW 8 34834493 missense probably damaging 1.00
R7015:Tnks UTSW 8 34838547 missense probably benign 0.04
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7475:Tnks UTSW 8 34831712 missense probably damaging 1.00
R7790:Tnks UTSW 8 34861540 missense probably benign 0.01
R7818:Tnks UTSW 8 34873028 missense probably benign 0.03
R7909:Tnks UTSW 8 34940704 missense probably damaging 1.00
R8341:Tnks UTSW 8 34873045 missense probably damaging 1.00
R8343:Tnks UTSW 8 34834584 missense probably benign 0.03
R8870:Tnks UTSW 8 34847279 critical splice donor site probably null
R8936:Tnks UTSW 8 34853347 nonsense probably null
R9049:Tnks UTSW 8 34841778 missense probably damaging 0.96
R9080:Tnks UTSW 8 34965312 small deletion probably benign
R9182:Tnks UTSW 8 34841751 critical splice donor site probably null
R9211:Tnks UTSW 8 34849335 missense probably damaging 1.00
R9425:Tnks UTSW 8 34873665 missense probably damaging 1.00
Z1177:Tnks UTSW 8 34965145 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CGACTGTAATAGGCAAACTGTTC -3'
(R):5'- TCTGTGTCTGTGTGTACACCAC -3'

Sequencing Primer
(F):5'- GGGTGACCGATGACTCAATCTTC -3'
(R):5'- GTGTACACCACAAAAGCAACTCTG -3'
Posted On 2020-09-15