Mutagenetix > Incidental Mutation

Incidental Mutation 'R4659:Tnks'

352680

Institutional Source

Beutler Lab

Gene Symbol

Tnks

Ensembl Gene

ENSMUSG00000031529

Gene Name

tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Synonyms

mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1

MMRRC Submission

041919-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4659 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34826460-34965690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 34849311 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 885 (Y885D)

Ref Sequence

ENSEMBL: ENSMUSP00000033929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033929]

AlphaFold

Q6PFX9

PDB Structure

Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033929
AA Change: Y885D

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: Y885D

Domain	Start	End	E-Value	Type
low complexity region	8	17	N/A	INTRINSIC
low complexity region	20	55	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
low complexity region	91	175	N/A	INTRINSIC
ANK	208	237	4.26e-4	SMART
ANK	241	270	3.23e-4	SMART
ANK	274	303	3.28e-5	SMART
ANK	327	355	2.66e3	SMART
ANK	361	390	7.64e-6	SMART
ANK	394	423	2.62e-4	SMART
ANK	427	456	1.99e-4	SMART
ANK	514	546	3.18e-3	SMART
ANK	550	579	1.51e-4	SMART
ANK	583	612	4.26e-4	SMART
ANK	642	670	2.21e3	SMART
ANK	676	705	4.03e-5	SMART
ANK	709	738	2.48e-5	SMART
ANK	742	771	1.64e-5	SMART
low complexity region	792	810	N/A	INTRINSIC
ANK	829	858	1.47e-7	SMART
ANK	862	891	2.21e-2	SMART
ANK	895	924	3.13e-2	SMART
low complexity region	996	1010	N/A	INTRINSIC
SAM	1017	1082	1.14e-12	SMART
Pfam:PARP	1098	1303	1.5e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209904

Meta Mutation Damage Score

0.1422

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

96% (74/77)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	T	15: 8,216,276		probably benign	Het
Abcc9	C	A	6: 142,672,595		probably null	Het
Ankrd22	C	T	19: 34,125,568	V118I	probably damaging	Het
Aoc1	A	T	6: 48,906,076	E295D	probably benign	Het
Arap2	T	C	5: 62,654,126	N1114S	possibly damaging	Het
AU021092	C	G	16: 5,212,147	A335P	probably damaging	Het
Carhsp1	T	C	16: 8,664,265	T51A	probably benign	Het
Ccdc144b	T	C	3: 36,025,954	D218G	possibly damaging	Het
Cdc42bpb	T	C	12: 111,339,891	D152G	probably damaging	Het
Cep70	T	A	9: 99,296,341	D497E	possibly damaging	Het
Chrm5	T	C	2: 112,479,757	N338S	probably benign	Het
Cldn8	G	A	16: 88,562,408	H210Y	probably benign	Het
Clhc1	T	A	11: 29,578,229	*586K	probably null	Het
Dopey1	T	A	9: 86,502,032		probably benign	Het
Dync1h1	T	C	12: 110,628,767	F1371S	possibly damaging	Het
Eif6	A	G	2: 155,826,181	I46T	probably damaging	Het
Esco2	G	A	14: 65,826,586	T383M	possibly damaging	Het
Exoc8	T	C	8: 124,897,532	D32G	probably damaging	Het
Fam149b	G	T	14: 20,367,873	S216I	probably benign	Het
Fam219a	T	C	4: 41,521,645	D87G	probably null	Het
Fbxw26	A	T	9: 109,744,871	V71D	probably damaging	Het
Gabra4	T	A	5: 71,641,144	K164M	probably damaging	Het
Gm8603	G	A	17: 13,517,028		noncoding transcript	Het
Gnmt	A	G	17: 46,725,966	F239S	probably damaging	Het
Gpsm1	G	A	2: 26,319,831		probably benign	Het
Jam2	G	A	16: 84,812,952	V151M	probably damaging	Het
Kcnj1	A	T	9: 32,394,148	D2V	probably benign	Het
Limch1	C	T	5: 67,027,557	R797C	probably damaging	Het
Lrrc9	T	A	12: 72,470,264	F597I	probably damaging	Het
Lrriq3	T	A	3: 155,129,453	I275N	possibly damaging	Het
Mcoln1	T	A	8: 3,510,840	S387R	probably damaging	Het
Mgst3	T	A	1: 167,377,279	Q58L	probably damaging	Het
Mical1	G	A	10: 41,486,936		probably benign	Het
Mmp3	C	A	9: 7,453,673	D431E	probably benign	Het
Mx1	T	C	16: 97,455,239		probably null	Het
Myo7a	A	G	7: 98,085,466	L607P	probably damaging	Het
Myt1l	A	G	12: 29,849,457	N153D	probably damaging	Het
Nfu1	A	T	6: 87,019,426	T120S	probably damaging	Het
Nhlrc2	T	C	19: 56,576,267	V341A	possibly damaging	Het
Notch1	T	C	2: 26,470,889	E1148G	probably damaging	Het
Nqo1	C	T	8: 107,391,044		probably null	Het
Nwd1	T	A	8: 72,695,321	D998E	probably benign	Het
Olfr1049	G	A	2: 86,255,013	Q227*	probably null	Het
Oxct2a	T	C	4: 123,322,680	I303V	probably benign	Het
Parp10	A	T	15: 76,242,985	D58E	probably damaging	Het
Pcdha6	T	A	18: 36,969,239	V495E	probably damaging	Het
Pitrm1	T	A	13: 6,553,182	S88R	probably benign	Het
Pxdn	T	C	12: 29,994,553	V510A	probably benign	Het
Ranbp17	T	A	11: 33,266,288	D820V	probably damaging	Het
Sec24c	G	T	14: 20,683,144	G180C	probably damaging	Het
Serpina3n	T	C	12: 104,413,493	S382P	probably benign	Het
Sestd1	A	T	2: 77,212,499	M237K	probably null	Het
Sf3a2	T	C	10: 80,803,584	I136T	probably damaging	Het
Sh3tc2	A	G	18: 61,974,509	Y197C	probably benign	Het
Speer4b	T	C	5: 27,497,895	K204E	probably benign	Het
Speer4f1	A	C	5: 17,476,223	E33A	possibly damaging	Het
Sspo	T	A	6: 48,484,213	D3529E	probably damaging	Het
Stard13	T	C	5: 151,062,788	D419G	probably benign	Het
Tg	A	G	15: 66,673,920	S164G	possibly damaging	Het
Thap12	A	G	7: 98,710,091		probably benign	Het
Thsd1	C	A	8: 22,259,298	Y667*	probably null	Het
Ttll3	A	G	6: 113,414,141	I896V	probably benign	Het
Txnip	T	G	3: 96,559,427	F190C	probably damaging	Het
Urb1	T	C	16: 90,776,129	D1005G	probably damaging	Het
Usp3	T	C	9: 66,527,070		probably null	Het
Usp54	G	T	14: 20,564,992	Q794K	probably damaging	Het
Xrn2	A	G	2: 147,061,474	Q798R	probably benign	Het
Zfp189	A	G	4: 49,530,342	I482V	probably benign	Het
Zfp28	A	G	7: 6,393,507	N314D	probably benign	Het
Zmym4	A	G	4: 126,948,428		probably null	Het

Other mutations in Tnks

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Tnks	APN	8	34861689	splice site	probably benign
IGL00901:Tnks	APN	8	34838395	nonsense	probably null
IGL01448:Tnks	APN	8	34839982	missense	probably damaging	1.00
IGL01455:Tnks	APN	8	34940900	missense	probably damaging	0.99
IGL01962:Tnks	APN	8	34869524	missense	probably damaging	1.00
IGL02088:Tnks	APN	8	34839994	missense	possibly damaging	0.50
IGL02260:Tnks	APN	8	34842983	missense	probably damaging	0.99
IGL02454:Tnks	APN	8	34831728	unclassified	probably benign
IGL02486:Tnks	APN	8	34851198	missense	probably damaging	1.00
IGL02612:Tnks	APN	8	34849299	missense	possibly damaging	0.48
IGL03179:Tnks	APN	8	34848670	missense	probably benign	0.38
IGL03404:Tnks	APN	8	34940704	missense	probably damaging	1.00
R0256:Tnks	UTSW	8	34861547	missense	probably benign	0.07
R0265:Tnks	UTSW	8	34839970	nonsense	probably null
R0334:Tnks	UTSW	8	34853259	nonsense	probably null
R0414:Tnks	UTSW	8	34853309	missense	probably damaging	1.00
R0526:Tnks	UTSW	8	34853303	missense	probably benign	0.23
R0622:Tnks	UTSW	8	34940822	missense	probably damaging	1.00
R1445:Tnks	UTSW	8	34834603	splice site	probably benign
R1618:Tnks	UTSW	8	34875276	missense	probably damaging	1.00
R1779:Tnks	UTSW	8	34857518	missense	probably benign	0.18
R1919:Tnks	UTSW	8	34875232	missense	probably damaging	1.00
R1938:Tnks	UTSW	8	34838530	missense	probably damaging	1.00
R2018:Tnks	UTSW	8	34851106	missense	probably damaging	1.00
R2198:Tnks	UTSW	8	34848649	missense	probably benign
R2198:Tnks	UTSW	8	34873067	missense	probably benign	0.29
R2925:Tnks	UTSW	8	34965661	missense	unknown
R3828:Tnks	UTSW	8	34873178	missense	probably damaging	1.00
R3913:Tnks	UTSW	8	34873074	missense	probably damaging	0.99
R3916:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3917:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3930:Tnks	UTSW	8	34940812	missense	probably damaging	1.00
R4760:Tnks	UTSW	8	34851783	missense	probably benign	0.38
R5091:Tnks	UTSW	8	34841809	missense	probably benign	0.40
R5419:Tnks	UTSW	8	34965566	missense	unknown
R5558:Tnks	UTSW	8	34965665	start codon destroyed	probably null
R5582:Tnks	UTSW	8	34940861	missense	probably benign	0.14
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6495:Tnks	UTSW	8	34839966	critical splice donor site	probably null
R6527:Tnks	UTSW	8	34873093	missense	probably benign	0.36
R6991:Tnks	UTSW	8	34834493	missense	probably damaging	1.00
R7015:Tnks	UTSW	8	34838547	missense	probably benign	0.04
R7038:Tnks	UTSW	8	34851636	missense	probably damaging	0.99
R7057:Tnks	UTSW	8	34840014	missense	probably damaging	1.00
R7167:Tnks	UTSW	8	34849304	missense	probably damaging	0.98
R7250:Tnks	UTSW	8	34851758	missense	probably damaging	0.98
R7475:Tnks	UTSW	8	34831712	missense	probably damaging	1.00
R7790:Tnks	UTSW	8	34861540	missense	probably benign	0.01
R7818:Tnks	UTSW	8	34873028	missense	probably benign	0.03
R7909:Tnks	UTSW	8	34940704	missense	probably damaging	1.00
R7970:Tnks	UTSW	8	34855926	critical splice donor site	probably null
R8341:Tnks	UTSW	8	34873045	missense	probably damaging	1.00
R8343:Tnks	UTSW	8	34834584	missense	probably benign	0.03
R8870:Tnks	UTSW	8	34847279	critical splice donor site	probably null
R8936:Tnks	UTSW	8	34853347	nonsense	probably null
R9049:Tnks	UTSW	8	34841778	missense	probably damaging	0.96
R9080:Tnks	UTSW	8	34965312	small deletion	probably benign
R9182:Tnks	UTSW	8	34841751	critical splice donor site	probably null
R9211:Tnks	UTSW	8	34849335	missense	probably damaging	1.00
R9425:Tnks	UTSW	8	34873665	missense	probably damaging	1.00
R9649:Tnks	UTSW	8	34838935	missense	probably damaging	0.96
Z1177:Tnks	UTSW	8	34965145	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GGTCATGCCTGGAATCCTAATG -3'
(R):5'- GCTGAGTAGGAGACAAGTCC -3'

Sequencing Primer
(F):5'- TGCCTGGAATCCTAATGTACAAC -3'
(R):5'- GCACAGGAGAAGACTGTTTTTG -3'

Posted On

2015-10-08