Mutagenetix > Incidental Mutation

Incidental Mutation 'R8465:Rims1'

656733

Institutional Source

Beutler Lab

Gene Symbol

Rims1

Ensembl Gene

ENSMUSG00000041670

Gene Name

regulating synaptic membrane exocytosis 1

Synonyms

RIM1a, RIM1, RIM1alpha, C030033M19Rik

MMRRC Submission

067909-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.644) question?

Stock #

R8465 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22286251-22805994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22428480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 767 (N767S)

Ref Sequence

ENSEMBL: ENSMUSP00000095419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000081544
AA Change: N767S

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670
AA Change: N767S

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	2.6e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	899	934	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC
C2	1120	1223	7.45e-15	SMART
low complexity region	1245	1253	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097809
AA Change: N767S

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670
AA Change: N767S

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	1e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	862	874	N/A	INTRINSIC
low complexity region	974	1009	N/A	INTRINSIC
low complexity region	1086	1100	N/A	INTRINSIC
C2	1195	1298	7.45e-15	SMART
low complexity region	1320	1328	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097810
AA Change: N767S

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670
AA Change: N767S

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
PDB:2CJS\|C	131	193	2e-32	PDB
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	862	874	N/A	INTRINSIC
low complexity region	916	929	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
low complexity region	1147	1161	N/A	INTRINSIC
C2	1256	1359	7.45e-15	SMART
low complexity region	1381	1389	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097811
AA Change: N767S

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670
AA Change: N767S

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	1.6e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	867	881	N/A	INTRINSIC
low complexity region	944	957	N/A	INTRINSIC
low complexity region	1063	1098	N/A	INTRINSIC
low complexity region	1175	1189	N/A	INTRINSIC
C2	1284	1387	7.45e-15	SMART
low complexity region	1409	1417	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115273
AA Change: N767S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670
AA Change: N767S

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	2.8e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	950	985	N/A	INTRINSIC
low complexity region	1062	1076	N/A	INTRINSIC
C2	1171	1274	7.45e-15	SMART
low complexity region	1296	1304	N/A	INTRINSIC

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	T	10: 82,316,464	L23M	possibly damaging	Het
Acot6	A	T	12: 84,106,441		probably null	Het
Adamtsl3	A	T	7: 82,598,122	N1429Y	probably benign	Het
Adk	T	C	14: 21,103,824	S32P	possibly damaging	Het
Akap13	A	T	7: 75,727,038	M2005L	probably benign	Het
Atp10a	A	T	7: 58,828,310	D1367V	probably benign	Het
Bckdhb	A	G	9: 83,988,862	I142V	probably benign	Het
Brap	C	T	5: 121,679,295	Q322*	probably null	Het
Carmil3	A	T	14: 55,496,848	N401I	probably damaging	Het
Cdan1	A	T	2: 120,728,440	S426T	possibly damaging	Het
Cdc27	C	A	11: 104,517,491	S531I	probably benign	Het
Cela3a	A	T	4: 137,403,874	Y184*	probably null	Het
Cep63	T	C	9: 102,613,377	K178R	probably benign	Het
Cfb	G	A	17: 34,857,314	Q152*	probably null	Het
Cnpy2	G	A	10: 128,326,175	V106I	probably benign	Het
Cntn1	GCTGTCTTC	GC	15: 92,339,523		probably null	Het
Ctc1	G	A	11: 69,026,219	G67D	probably damaging	Het
Cwc27	G	T	13: 104,804,264	P196T	probably benign	Het
Cwc27	C	A	13: 104,804,268	L194F	possibly damaging	Het
Cyp2d12	T	G	15: 82,555,177	S11A	possibly damaging	Het
Ddx55	T	A	5: 124,559,121		probably null	Het
Dedd2	G	T	7: 25,218,906	R75S	probably damaging	Het
Fat2	G	A	11: 55,256,704	S3904F	possibly damaging	Het
Fibp	G	A	19: 5,463,187	V177I	probably damaging	Het
Fsip2	A	T	2: 82,979,940	E2201V	probably benign	Het
Gbp11	C	T	5: 105,325,062	D499N	probably benign	Het
Gfm1	A	G	3: 67,431,699	E45G	probably damaging	Het
Gm884	T	A	11: 103,616,121		probably benign	Het
H2-D1	A	G	17: 35,263,511	Y69C	probably damaging	Het
Hcar1	A	G	5: 123,879,046	F194S	probably damaging	Het
Heatr4	A	T	12: 83,977,933		probably null	Het
Kcnd2	G	A	6: 21,216,696	C133Y	probably damaging	Het
Kcnq1	A	T	7: 143,425,974	Q619L	probably benign	Het
Kctd12	T	A	14: 102,981,465	R326W	probably damaging	Het
Kel	A	G	6: 41,689,538		probably null	Het
Lipk	A	T	19: 34,046,797	I332F	probably benign	Het
Masp2	A	G	4: 148,612,059	D371G	possibly damaging	Het
Met	A	G	6: 17,571,810	E1376G	probably benign	Het
Mup5	A	T	4: 61,833,778	I78K	probably benign	Het
Mynn	A	T	3: 30,616,641	D526V	probably damaging	Het
Naip6	G	T	13: 100,296,915	T1138N	possibly damaging	Het
Neurod1	G	T	2: 79,454,352	P229Q	probably damaging	Het
Npepps	T	G	11: 97,248,259	R162S	probably damaging	Het
Ntrk3	T	A	7: 78,462,883	Q175L	probably damaging	Het
Obsl1	T	C	1: 75,503,388	T310A	probably damaging	Het
Olfr1062	A	T	2: 86,423,631	M15K	probably benign	Het
Olfr1079	A	G	2: 86,538,387	I176T	probably damaging	Het
Olfr1288	A	T	2: 111,479,080	T99S	probably benign	Het
Olfr25	A	T	9: 38,330,114	I176F	possibly damaging	Het
Pigf	G	A	17: 86,997,536	T193I	possibly damaging	Het
Pkp4	T	C	2: 59,342,181	V904A	possibly damaging	Het
Plekha6	C	T	1: 133,270,040	T141M	probably damaging	Het
Rapgef6	G	A	11: 54,691,482	D1407N	probably benign	Het
Rhobtb3	T	C	13: 75,939,622	D82G	probably damaging	Het
Ripor2	T	A	13: 24,665,468		probably benign	Het
Sec14l4	T	A	11: 4,043,948	I296N	probably damaging	Het
Serpinb12	G	T	1: 106,956,612	V363F	probably damaging	Het
Serpinb9c	A	G	13: 33,150,033	I342T	probably damaging	Het
Shmt2	A	G	10: 127,520,076	V133A	probably damaging	Het
Slc30a6	A	G	17: 74,415,666	M243V	probably benign	Het
Slfn2	T	A	11: 83,069,661	N155K	probably damaging	Het
Syne2	A	T	12: 75,854,124	D19V	possibly damaging	Het
Tcl1b3	A	T	12: 105,194,477	I116L	probably benign	Het
Tcp11	A	G	17: 28,067,792	I411T	probably damaging	Het
Tctn1	C	T	5: 122,241,796	A560T	probably benign	Het
Tenm3	C	A	8: 48,229,181	Q2471H	probably damaging	Het
Tnr	A	G	1: 159,886,075	D691G	probably benign	Het
Ube3b	C	T	5: 114,390,390	P150S	probably damaging	Het
Ugt2b5	T	C	5: 87,139,659	I216M	possibly damaging	Het
Unc5d	T	A	8: 28,666,849	R789S	probably damaging	Het
Ush2a	G	A	1: 188,415,678	G934D	probably damaging	Het
Usp6nl	A	T	2: 6,394,541	R70S	probably damaging	Het
Vmn1r181	T	C	7: 23,984,884	I258T	possibly damaging	Het
Vmn2r15	C	A	5: 109,297,436	D41Y	probably damaging	Het
Vmn2r17	T	A	5: 109,452,825	I663N	probably damaging	Het
Vnn3	C	A	10: 23,865,882	Q362K	possibly damaging	Het
Wdr72	A	G	9: 74,152,448	D380G	possibly damaging	Het
Wfdc10	G	A	2: 164,657,260	E97K	possibly damaging	Het
Xdh	A	T	17: 73,899,012	C1002*	probably null	Het
Zscan4e	A	C	7: 11,307,651	V126G	probably damaging	Het

Other mutations in Rims1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Rims1	APN	1	22468242	missense	probably damaging	1.00
IGL00535:Rims1	APN	1	22432921	missense	probably benign	0.02
IGL01021:Rims1	APN	1	22486620	missense	probably damaging	1.00
IGL01106:Rims1	APN	1	22379447	missense	probably damaging	1.00
IGL01128:Rims1	APN	1	22534175	missense	probably damaging	0.97
IGL01548:Rims1	APN	1	22538602	missense	probably damaging	1.00
IGL01688:Rims1	APN	1	22397540	missense	probably benign	0.22
IGL02089:Rims1	APN	1	22630475	missense	possibly damaging	0.68
IGL02245:Rims1	APN	1	22346488	missense	probably damaging	0.98
IGL02355:Rims1	APN	1	22483207	missense	probably damaging	1.00
IGL02362:Rims1	APN	1	22483207	missense	probably damaging	1.00
IGL02682:Rims1	APN	1	22288484	missense	probably damaging	1.00
IGL03006:Rims1	APN	1	22296954	missense	probably damaging	0.99
IGL03054:Rims1	UTSW	1	22290109	missense	probably damaging	1.00
PIT4504001:Rims1	UTSW	1	22397460	missense
R0031:Rims1	UTSW	1	22296879	missense	probably damaging	1.00
R0118:Rims1	UTSW	1	22346407	missense	probably damaging	1.00
R0390:Rims1	UTSW	1	22596526	missense	possibly damaging	0.92
R0483:Rims1	UTSW	1	22468182	splice site	probably benign
R0744:Rims1	UTSW	1	22427459	splice site	probably null
R0836:Rims1	UTSW	1	22427459	splice site	probably null
R1218:Rims1	UTSW	1	22483175	missense	probably damaging	1.00
R1228:Rims1	UTSW	1	22472756	missense	probably null	1.00
R1374:Rims1	UTSW	1	22296948	missense	probably damaging	1.00
R1474:Rims1	UTSW	1	22538281	splice site	probably benign
R1652:Rims1	UTSW	1	22292866	missense	probably damaging	1.00
R1712:Rims1	UTSW	1	22296948	missense	probably damaging	1.00
R1730:Rims1	UTSW	1	22346529	critical splice acceptor site	probably null
R1783:Rims1	UTSW	1	22346529	critical splice acceptor site	probably null
R1861:Rims1	UTSW	1	22596558	missense	probably damaging	1.00
R1899:Rims1	UTSW	1	22428474	missense	probably damaging	1.00
R1937:Rims1	UTSW	1	22288530	missense	probably damaging	1.00
R2010:Rims1	UTSW	1	22296996	missense	probably damaging	1.00
R2049:Rims1	UTSW	1	22596435	missense	probably damaging	1.00
R2124:Rims1	UTSW	1	22404508	nonsense	probably null
R2860:Rims1	UTSW	1	22432976	missense	probably benign	0.01
R2861:Rims1	UTSW	1	22432976	missense	probably benign	0.01
R2914:Rims1	UTSW	1	22805630	missense	probably damaging	1.00
R3740:Rims1	UTSW	1	22373443	missense	probably damaging	1.00
R3741:Rims1	UTSW	1	22373443	missense	probably damaging	1.00
R3773:Rims1	UTSW	1	22421810	missense	probably damaging	1.00
R3874:Rims1	UTSW	1	22428489	missense	probably damaging	1.00
R3901:Rims1	UTSW	1	22533497	missense	probably benign	0.00
R3964:Rims1	UTSW	1	22427459	splice site	probably null
R4037:Rims1	UTSW	1	22475712	missense	probably damaging	0.96
R4039:Rims1	UTSW	1	22475712	missense	probably damaging	0.96
R4056:Rims1	UTSW	1	22292939	splice site	probably benign
R4062:Rims1	UTSW	1	22533583	missense	probably benign	0.00
R4552:Rims1	UTSW	1	22373494	missense	probably damaging	0.99
R4658:Rims1	UTSW	1	22427543	missense	probably damaging	0.98
R4688:Rims1	UTSW	1	22479447	nonsense	probably null
R4696:Rims1	UTSW	1	22288612	missense	probably damaging	1.00
R4720:Rims1	UTSW	1	22427481	missense	probably damaging	1.00
R4764:Rims1	UTSW	1	22479462	missense	probably damaging	1.00
R4780:Rims1	UTSW	1	22291105	missense	probably damaging	1.00
R4931:Rims1	UTSW	1	22533947	missense	probably benign	0.26
R5137:Rims1	UTSW	1	22288620	nonsense	probably null
R5153:Rims1	UTSW	1	22483247	nonsense	probably null
R5305:Rims1	UTSW	1	22596542	missense	probably damaging	0.99
R5354:Rims1	UTSW	1	22538511	missense	probably damaging	1.00
R5386:Rims1	UTSW	1	22412245	missense	probably damaging	0.99
R5485:Rims1	UTSW	1	22483208	missense	possibly damaging	0.93
R5643:Rims1	UTSW	1	22538509	missense	probably damaging	1.00
R5929:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
R5988:Rims1	UTSW	1	22596463	missense	probably damaging	1.00
R6160:Rims1	UTSW	1	22432984	missense	probably damaging	0.98
R6579:Rims1	UTSW	1	22425916	missense	probably damaging	1.00
R6790:Rims1	UTSW	1	22468197	missense	probably damaging	1.00
R7048:Rims1	UTSW	1	22472820	missense	probably damaging	1.00
R7100:Rims1	UTSW	1	22346473	missense	probably benign	0.27
R7155:Rims1	UTSW	1	22432923	missense	probably damaging	0.99
R7171:Rims1	UTSW	1	22428489	missense
R7448:Rims1	UTSW	1	22404475	missense
R7505:Rims1	UTSW	1	22533996	missense	possibly damaging	0.55
R7567:Rims1	UTSW	1	22468210	missense	probably damaging	0.99
R7639:Rims1	UTSW	1	22805669	missense	probably benign	0.02
R7955:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
R8005:Rims1	UTSW	1	22412213	missense
R8071:Rims1	UTSW	1	22288536	nonsense	probably null
R8517:Rims1	UTSW	1	22483165	missense	probably damaging	1.00
R8703:Rims1	UTSW	1	22425887	missense
R8726:Rims1	UTSW	1	22594100	missense	possibly damaging	0.88
R9090:Rims1	UTSW	1	22428522	missense
R9179:Rims1	UTSW	1	22412266	missense	probably damaging	0.99
R9271:Rims1	UTSW	1	22428522	missense
R9291:Rims1	UTSW	1	22397522	missense
R9394:Rims1	UTSW	1	22472775	missense	probably damaging	1.00
R9578:Rims1	UTSW	1	22484742	missense	probably damaging	1.00
R9614:Rims1	UTSW	1	22421745	nonsense	probably null
R9726:Rims1	UTSW	1	22630412	missense	probably null	0.21
Z1088:Rims1	UTSW	1	22288586	missense	probably damaging	1.00
Z1176:Rims1	UTSW	1	22484671	nonsense	probably null
Z1177:Rims1	UTSW	1	22296939	missense	possibly damaging	0.93
Z1177:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
Z1177:Rims1	UTSW	1	22472777	missense	probably benign	0.44
Z1177:Rims1	UTSW	1	22472804	missense	probably damaging	1.00
Z1186:Rims1	UTSW	1	22379482	missense

Predicted Primers

PCR Primer
(F):5'- TTGGAACCCCTGTAGGAAAAGC -3'
(R):5'- AGCAGGTCAATGGCTGCTTTG -3'

Sequencing Primer
(F):5'- CAAGGGTTCTGCTAACTAATGGC -3'
(R):5'- GTTCTGCTCCTGTCGTAAAAAG -3'

Posted On

2021-01-18