Incidental Mutation 'R8465:Tenm3'
ID 656772
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Name teneurin transmembrane protein 3
Synonyms Ten-m3, Odz3, 2610100B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 48227682-48843951 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 48229181 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 2471 (Q2471H)
Ref Sequence ENSEMBL: ENSMUSP00000033965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033965
AA Change: Q2471H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: Q2471H

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190840
AA Change: Q2455H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: Q2455H

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,316,464 L23M possibly damaging Het
Acot6 A T 12: 84,106,441 probably null Het
Adamtsl3 A T 7: 82,598,122 N1429Y probably benign Het
Adk T C 14: 21,103,824 S32P possibly damaging Het
Akap13 A T 7: 75,727,038 M2005L probably benign Het
Atp10a A T 7: 58,828,310 D1367V probably benign Het
Bckdhb A G 9: 83,988,862 I142V probably benign Het
Brap C T 5: 121,679,295 Q322* probably null Het
Carmil3 A T 14: 55,496,848 N401I probably damaging Het
Cdan1 A T 2: 120,728,440 S426T possibly damaging Het
Cdc27 C A 11: 104,517,491 S531I probably benign Het
Cela3a A T 4: 137,403,874 Y184* probably null Het
Cep63 T C 9: 102,613,377 K178R probably benign Het
Cfb G A 17: 34,857,314 Q152* probably null Het
Cnpy2 G A 10: 128,326,175 V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,339,523 probably null Het
Ctc1 G A 11: 69,026,219 G67D probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp2d12 T G 15: 82,555,177 S11A possibly damaging Het
Ddx55 T A 5: 124,559,121 probably null Het
Dedd2 G T 7: 25,218,906 R75S probably damaging Het
Fat2 G A 11: 55,256,704 S3904F possibly damaging Het
Fibp G A 19: 5,463,187 V177I probably damaging Het
Fsip2 A T 2: 82,979,940 E2201V probably benign Het
Gbp11 C T 5: 105,325,062 D499N probably benign Het
Gfm1 A G 3: 67,431,699 E45G probably damaging Het
Gm884 T A 11: 103,616,121 probably benign Het
H2-D1 A G 17: 35,263,511 Y69C probably damaging Het
Hcar1 A G 5: 123,879,046 F194S probably damaging Het
Heatr4 A T 12: 83,977,933 probably null Het
Kcnd2 G A 6: 21,216,696 C133Y probably damaging Het
Kcnq1 A T 7: 143,425,974 Q619L probably benign Het
Kctd12 T A 14: 102,981,465 R326W probably damaging Het
Kel A G 6: 41,689,538 probably null Het
Lipk A T 19: 34,046,797 I332F probably benign Het
Masp2 A G 4: 148,612,059 D371G possibly damaging Het
Met A G 6: 17,571,810 E1376G probably benign Het
Mup5 A T 4: 61,833,778 I78K probably benign Het
Mynn A T 3: 30,616,641 D526V probably damaging Het
Naip6 G T 13: 100,296,915 T1138N possibly damaging Het
Neurod1 G T 2: 79,454,352 P229Q probably damaging Het
Npepps T G 11: 97,248,259 R162S probably damaging Het
Ntrk3 T A 7: 78,462,883 Q175L probably damaging Het
Obsl1 T C 1: 75,503,388 T310A probably damaging Het
Olfr1062 A T 2: 86,423,631 M15K probably benign Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1288 A T 2: 111,479,080 T99S probably benign Het
Olfr25 A T 9: 38,330,114 I176F possibly damaging Het
Pigf G A 17: 86,997,536 T193I possibly damaging Het
Pkp4 T C 2: 59,342,181 V904A possibly damaging Het
Plekha6 C T 1: 133,270,040 T141M probably damaging Het
Rapgef6 G A 11: 54,691,482 D1407N probably benign Het
Rhobtb3 T C 13: 75,939,622 D82G probably damaging Het
Rims1 T C 1: 22,428,480 N767S possibly damaging Het
Ripor2 T A 13: 24,665,468 probably benign Het
Sec14l4 T A 11: 4,043,948 I296N probably damaging Het
Serpinb12 G T 1: 106,956,612 V363F probably damaging Het
Serpinb9c A G 13: 33,150,033 I342T probably damaging Het
Shmt2 A G 10: 127,520,076 V133A probably damaging Het
Slc30a6 A G 17: 74,415,666 M243V probably benign Het
Slfn2 T A 11: 83,069,661 N155K probably damaging Het
Syne2 A T 12: 75,854,124 D19V possibly damaging Het
Tcl1b3 A T 12: 105,194,477 I116L probably benign Het
Tcp11 A G 17: 28,067,792 I411T probably damaging Het
Tctn1 C T 5: 122,241,796 A560T probably benign Het
Tnr A G 1: 159,886,075 D691G probably benign Het
Ube3b C T 5: 114,390,390 P150S probably damaging Het
Ugt2b5 T C 5: 87,139,659 I216M possibly damaging Het
Unc5d T A 8: 28,666,849 R789S probably damaging Het
Ush2a G A 1: 188,415,678 G934D probably damaging Het
Usp6nl A T 2: 6,394,541 R70S probably damaging Het
Vmn1r181 T C 7: 23,984,884 I258T possibly damaging Het
Vmn2r15 C A 5: 109,297,436 D41Y probably damaging Het
Vmn2r17 T A 5: 109,452,825 I663N probably damaging Het
Vnn3 C A 10: 23,865,882 Q362K possibly damaging Het
Wdr72 A G 9: 74,152,448 D380G possibly damaging Het
Wfdc10 G A 2: 164,657,260 E97K possibly damaging Het
Xdh A T 17: 73,899,012 C1002* probably null Het
Zscan4e A C 7: 11,307,651 V126G probably damaging Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48235607 missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48293657 missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48276156 missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48343316 missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48417179 missense probably benign 0.05
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1863:Tenm3 UTSW 8 48276346 missense probably benign 0.20
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48417006 critical splice donor site probably null
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48674550 missense probably benign 0.17
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2237:Tenm3 UTSW 8 48342337 missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48278961 nonsense probably null
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48235826 missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48646498 missense probably benign 0.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48417059 missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense probably benign 0.00
R7140:Tenm3 UTSW 8 48292236 missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48300969 missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48235935 missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48236177 missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48236183 missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48287812 missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48276600 missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48341049 missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48335727 missense probably benign 0.27
R7734:Tenm3 UTSW 8 48646333 missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48236465 missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48276300 missense probably benign 0.01
R7843:Tenm3 UTSW 8 48229111 nonsense probably null
R7951:Tenm3 UTSW 8 48310703 missense possibly damaging 0.86
R8293:Tenm3 UTSW 8 48367422 missense possibly damaging 0.91
R8336:Tenm3 UTSW 8 48293773 missense probably damaging 1.00
R8351:Tenm3 UTSW 8 48287872 missense probably damaging 0.96
R8387:Tenm3 UTSW 8 48287848 missense probably damaging 0.98
R8414:Tenm3 UTSW 8 48293509 missense probably damaging 1.00
R8451:Tenm3 UTSW 8 48287872 missense probably damaging 0.96
R8528:Tenm3 UTSW 8 48342633 missense probably damaging 1.00
R8717:Tenm3 UTSW 8 48299645 missense possibly damaging 0.77
R8734:Tenm3 UTSW 8 48349356 missense probably benign 0.16
R8781:Tenm3 UTSW 8 48342449 frame shift probably null
R8820:Tenm3 UTSW 8 48310724 missense probably damaging 0.96
R8821:Tenm3 UTSW 8 48276382 missense
R8831:Tenm3 UTSW 8 48276382 missense
R8853:Tenm3 UTSW 8 48342347 missense probably damaging 1.00
R8900:Tenm3 UTSW 8 48236402 missense probably damaging 1.00
R8931:Tenm3 UTSW 8 48235602 missense probably damaging 1.00
R8933:Tenm3 UTSW 8 48279060 missense possibly damaging 0.53
R8989:Tenm3 UTSW 8 48235348 nonsense probably null
R8998:Tenm3 UTSW 8 48276687 missense probably damaging 1.00
R9008:Tenm3 UTSW 8 48342653 missense probably damaging 0.98
R9017:Tenm3 UTSW 8 48254633 missense probably damaging 0.99
R9101:Tenm3 UTSW 8 48292151 missense probably damaging 1.00
R9108:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R9142:Tenm3 UTSW 8 48335513 missense unknown
R9231:Tenm3 UTSW 8 48236196 missense probably damaging 1.00
R9309:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R9310:Tenm3 UTSW 8 48555900 unclassified probably benign
R9336:Tenm3 UTSW 8 48417080 missense probably damaging 1.00
R9373:Tenm3 UTSW 8 48299655 missense probably damaging 1.00
R9393:Tenm3 UTSW 8 48674524 missense probably damaging 0.99
R9509:Tenm3 UTSW 8 48313257 nonsense probably null
R9575:Tenm3 UTSW 8 48235761 missense possibly damaging 0.94
R9698:Tenm3 UTSW 8 48236211 missense probably damaging 1.00
R9722:Tenm3 UTSW 8 48300814 missense probably benign 0.00
R9788:Tenm3 UTSW 8 48335561 missense probably benign 0.02
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48276780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATGTTGAGCACGTTGGTC -3'
(R):5'- AGACCCGTTTTGTTTCCTGG -3'

Sequencing Primer
(F):5'- TGAGCACGTTGGTCTGCAC -3'
(R):5'- GGATAACCCTGAACTCACTGTGTAG -3'
Posted On 2021-01-18