Incidental Mutation 'R8791:Washc4'
ID670950
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R8791 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83550884 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 124 (T124I)
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect probably benign
Transcript: ENSMUST00000038388
AA Change: T124I

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: T124I

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,187,260 Y654C probably damaging Het
4931422A03Rik G T 2: 103,992,677 T87K possibly damaging Het
Adar G A 3: 89,736,138 R442Q probably benign Het
Agtr1b T A 3: 20,316,116 S109C probably damaging Het
Akr1c6 T A 13: 4,449,374 Y248N probably benign Het
Alpk2 A T 18: 65,305,526 V932E probably benign Het
Apba3 T A 10: 81,269,270 S126T probably benign Het
Brca2 T A 5: 150,542,596 S1942T possibly damaging Het
Ccdc149 C T 5: 52,439,210 C20Y probably damaging Het
Cd63 C A 10: 128,912,202 N156K probably benign Het
Clvs1 A G 4: 9,429,807 E270G probably damaging Het
Dgki A T 6: 37,019,940 D574E probably damaging Het
Esrrb A G 12: 86,470,282 S63G probably damaging Het
Exoc1 C T 5: 76,535,565 R46C probably damaging Het
Fcgr4 C A 1: 171,019,908 A25D probably damaging Het
Fgf4 T C 7: 144,861,671 V56A probably benign Het
Gfpt2 A G 11: 49,823,216 I267V probably benign Het
Gm20939 A C 17: 94,877,220 H432P probably damaging Het
Gpr179 A T 11: 97,351,913 L35Q probably damaging Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ildr1 T C 16: 36,708,400 I69T probably damaging Het
Lrfn1 A G 7: 28,459,919 D421G probably benign Het
Mmp15 C T 8: 95,369,660 Q360* probably null Het
Nfatc2 T C 2: 168,536,294 K484E probably damaging Het
Nkpd1 G C 7: 19,524,170 V625L probably benign Het
Nme9 T A 9: 99,468,248 I178N probably damaging Het
Nrp2 C T 1: 62,749,197 T352I probably damaging Het
Ntrk1 T C 3: 87,779,683 I723V probably damaging Het
Olfr469 C T 7: 107,823,350 V40M possibly damaging Het
Pias3 C A 3: 96,704,885 Q553K probably benign Het
Pnp2 T G 14: 50,963,416 H119Q probably benign Het
Rapgef6 T A 11: 54,568,469 D156E probably benign Het
Rint1 T C 5: 23,800,596 V92A probably damaging Het
Rnf148 A T 6: 23,654,994 M1K probably null Het
Rnh1 C T 7: 141,162,433 R404H probably benign Het
Slc4a8 T C 15: 100,807,253 V832A possibly damaging Het
Snx31 A T 15: 36,537,532 C167S probably benign Het
Spata13 C T 14: 60,691,826 R278C probably damaging Het
Spg20 A G 3: 55,121,679 D297G probably benign Het
Tmc1 T C 19: 20,789,845 T716A probably benign Het
Tpi1 A G 6: 124,812,520 V164A probably damaging Het
Trim17 A G 11: 58,971,176 S345G probably benign Het
Vmn1r199 T A 13: 22,383,517 L327Q probably damaging Het
Wdr76 C T 2: 121,527,003 T180I probably benign Het
Zcchc8 T C 5: 123,707,299 N333D probably benign Het
Zfp516 T C 18: 82,957,335 S553P probably damaging Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
R7144:Washc4 UTSW 10 83573774 critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83591033 missense probably damaging 0.99
R7477:Washc4 UTSW 10 83574443 missense probably damaging 0.99
R7900:Washc4 UTSW 10 83573773 splice site probably null
R8491:Washc4 UTSW 10 83576123 missense probably benign 0.24
R8804:Washc4 UTSW 10 83572151 missense probably damaging 0.99
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GATGGTCAGTGAGGAAGTCC -3'
(R):5'- AAATTGAGGGTTCCAGAGCC -3'

Sequencing Primer
(F):5'- ACAGAGCTTTGGGTCCGC -3'
(R):5'- TTACAAGTTTGAGGCCAGCC -3'
Posted On2021-04-30