Mutagenetix > Incidental Mutation

Incidental Mutation 'R8824:Afg1l'

673338

Institutional Source

Beutler Lab

Gene Symbol

Afg1l

Ensembl Gene

ENSMUSG00000038302

Gene Name

AFG1 like ATPase

Synonyms

Lace1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R8824 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42312585-42478565 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 42438387 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 128 (P128S)

Ref Sequence

ENSEMBL: ENSMUSP00000036149 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041024] [ENSMUST00000133326]

AlphaFold

Q3V384

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041024
AA Change: P128S

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000036149
Gene: ENSMUSG00000038302
AA Change: P128S

Domain	Start	End	E-Value	Type
low complexity region	21	32	N/A	INTRINSIC
low complexity region	34	43	N/A	INTRINSIC
Pfam:AFG1_ATPase	74	432	4.4e-110	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133326
AA Change: P128S

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000123510
Gene: ENSMUSG00000038302
AA Change: P128S

Domain	Start	End	E-Value	Type
low complexity region	21	32	N/A	INTRINSIC
low complexity region	34	43	N/A	INTRINSIC
Pfam:AFG1_ATPase	73	272	2e-64	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000151747

SMART Domains

Protein: ENSMUSP00000120389
Gene: ENSMUSG00000038302

Domain	Start	End	E-Value	Type
Pfam:AFG1_ATPase	5	300	2e-97	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial integral membrane protein that plays a role in mitochondrial protein homeostasis. The protein contains a P-loop motif and a five-domain structure that is conserved in fly, yeast, and bacteria. It functions to mediate the degradation of nuclear-encoded complex IV subunits. Two conserved estrogen receptor binding sites are located within 2.5 kb of this gene. Polymorphisms in this gene have been associated with bipolar disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Accsl	A	T	2: 93,862,850	V260D	probably damaging	Het
Adora2a	G	A	10: 75,326,179	A51T	probably damaging	Het
Ago4	C	A	4: 126,507,184	V623L	probably benign	Het
Akap11	A	T	14: 78,516,347	N112K		Het
C1ra	A	T	6: 124,517,695	I306F	probably damaging	Het
Ccdc73	A	G	2: 104,991,877	N724D	possibly damaging	Het
Cd248	A	G	19: 5,069,617	I498V	probably benign	Het
Clrn1	A	T	3: 58,884,893	S50T	probably benign	Het
Col7a1	A	G	9: 108,967,025	K1553R	unknown	Het
Cxcr6	A	C	9: 123,810,941	T343P	probably benign	Het
Cyp11b2	T	A	15: 74,856,065	Q56L	probably damaging	Het
Dip2a	A	G	10: 76,278,486		probably null	Het
Dnmbp	A	G	19: 43,849,837	V742A	probably benign	Het
Dusp16	A	T	6: 134,739,769	S192T	probably benign	Het
Ehbp1	A	T	11: 22,232,053	D87E	probably damaging	Het
Fgl1	A	G	8: 41,199,711	V150A	probably benign	Het
Flt3	T	C	5: 147,334,863	D873G	probably damaging	Het
Gart	T	C	16: 91,630,703	D469G	possibly damaging	Het
Gm28168	T	G	1: 117,947,895	S85A	probably benign	Het
Golgb1	A	G	16: 36,915,689	D1807G	probably benign	Het
Grm8	A	G	6: 27,761,352	L291S	probably damaging	Het
Gucy2d	C	T	7: 98,443,469	P18S	possibly damaging	Het
Ifna15	C	T	4: 88,557,761	C162Y	probably damaging	Het
Iqub	C	A	6: 24,479,308	E412*	probably null	Het
Krt4	T	A	15: 101,920,642	D312V		Het
Krtap26-1	A	T	16: 88,647,415	I106N	probably damaging	Het
Krtap26-1	T	C	16: 88,647,436	Y99C	probably damaging	Het
Lipn	T	C	19: 34,084,716	I357T	probably benign	Het
Lrrc14b	A	G	13: 74,363,949	L4P	probably damaging	Het
Mrgpra9	A	T	7: 47,235,293	C209S	probably benign	Het
Myh7b	A	G	2: 155,630,381	N1291D	probably benign	Het
Myo5a	A	G	9: 75,167,046	T746A	probably damaging	Het
Myom2	A	C	8: 15,114,169	E1021D	possibly damaging	Het
Ncoa2	C	T	1: 13,177,185	R338H	probably benign	Het
Ncor2	A	G	5: 125,118,757	F91L		Het
Neb	C	G	2: 52,216,911	A4407P	probably damaging	Het
Olfr1135	T	C	2: 87,671,960	M136V	possibly damaging	Het
Olfr1272	A	G	2: 90,296,012	I283T	probably damaging	Het
Olfr347	A	T	2: 36,735,191	Y290F	probably damaging	Het
Olfr502	T	G	7: 108,523,143	Y269S	probably benign	Het
Olfr74	A	G	2: 87,974,003	F221L	probably benign	Het
Olfr819	C	T	10: 129,965,792	V297M	probably damaging	Het
Peg10	T	TCCC	6: 4,756,451		probably benign	Het
Piwil4	C	A	9: 14,727,475	K298N	probably benign	Het
Prkcz	G	A	4: 155,344,828		probably benign	Het
Prkg2	G	A	5: 98,942,208	P691L	possibly damaging	Het
Ptprc	T	A	1: 138,113,708	K89*	probably null	Het
Rapgef3	C	T	15: 97,766,908	A25T	probably benign	Het
Rreb1	C	T	13: 37,930,516	T617I	probably damaging	Het
Rsph1	A	C	17: 31,273,376	V72G	possibly damaging	Het
Shc2	A	G	10: 79,637,702	V50A	probably benign	Het
Slc38a9	G	A	13: 112,701,487	R262H	probably benign	Het
Slco6c1	T	A	1: 97,128,159	N6Y	possibly damaging	Het
Smarca5	A	G	8: 80,705,332	F886L	probably benign	Het
Tas1r2	A	G	4: 139,653,763		probably benign	Het
Tnrc6c	T	A	11: 117,739,854		probably benign	Het
Trim30b	T	A	7: 104,357,906		probably benign	Het
Trim55	T	C	3: 19,672,962	S398P	probably benign	Het
Ttc39c	T	A	18: 12,686,946		probably benign	Het
Ubxn10	A	G	4: 138,735,867		probably null	Het
Usf3	A	G	16: 44,215,613	N152S	probably benign	Het
Vps13b	T	A	15: 35,533,299	V839E	probably damaging	Het
Zeb1	T	A	18: 5,748,680		probably benign	Het
Zfp780b	T	C	7: 27,963,468	Y554C	probably benign	Het
Zhx2	C	T	15: 57,821,280	T15I	probably damaging	Het

Other mutations in Afg1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01863:Afg1l	APN	10	42339911	missense	possibly damaging	0.86
IGL02041:Afg1l	APN	10	42454380	missense	probably damaging	0.98
IGL02309:Afg1l	APN	10	42454378	missense	possibly damaging	0.90
IGL02323:Afg1l	APN	10	42454510	nonsense	probably null
IGL03088:Afg1l	APN	10	42426497	missense	probably damaging	1.00
PIT4458001:Afg1l	UTSW	10	42454370	nonsense	probably null
R0969:Afg1l	UTSW	10	42318621	missense	probably damaging	1.00
R1665:Afg1l	UTSW	10	42426577	missense	probably damaging	1.00
R1703:Afg1l	UTSW	10	42400399	missense	probably damaging	1.00
R1766:Afg1l	UTSW	10	42454495	missense	probably benign	0.00
R2941:Afg1l	UTSW	10	42478295	splice site	probably null
R4846:Afg1l	UTSW	10	42454494	missense	probably benign	0.02
R4887:Afg1l	UTSW	10	42454378	missense	probably benign	0.00
R5668:Afg1l	UTSW	10	42360240	missense	probably damaging	1.00
R5934:Afg1l	UTSW	10	42318686	missense	probably damaging	1.00
R6575:Afg1l	UTSW	10	42318716	missense	probably damaging	1.00
R6972:Afg1l	UTSW	10	42478374	missense	probably benign	0.00
R7270:Afg1l	UTSW	10	42425249	missense	probably damaging	1.00
R7271:Afg1l	UTSW	10	42415548	critical splice donor site	probably null
R7577:Afg1l	UTSW	10	42318611	missense	probably damaging	1.00
R8458:Afg1l	UTSW	10	42426521	missense	probably damaging	0.98
R9032:Afg1l	UTSW	10	42318641	missense	probably damaging	1.00
R9085:Afg1l	UTSW	10	42318641	missense	probably damaging	1.00
R9443:Afg1l	UTSW	10	42313591	missense	probably damaging	1.00
Z1176:Afg1l	UTSW	10	42478353	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GTGACACTGCTTCTGCTTTAAC -3'
(R):5'- TTTGCAGACTTTCACACCAAG -3'

Sequencing Primer
(F):5'- GCCTATGAGCATCAATGGCG -3'
(R):5'- GCCTCCTTGATGTCCTATA -3'

Posted On

2021-07-15