Mutagenetix > Incidental Mutation

Incidental Mutation 'R8824:Ago4'

673315

Institutional Source

Beutler Lab

Gene Symbol

Ago4

Ensembl Gene

ENSMUSG00000042500

Gene Name

argonaute RISC catalytic subunit 4

Synonyms

argonaute 4, Eif2c4, 5730550L01Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R8824 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126489541-126533472 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 126507184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 623 (V623L)

Ref Sequence

ENSEMBL: ENSMUSP00000081312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084289]

AlphaFold

Q8CJF8

Predicted Effect

probably benign
Transcript: ENSMUST00000084289
AA Change: V623L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500
AA Change: V623L

Domain	Start	End	E-Value	Type
Pfam:ArgoN	18	156	3.9e-28	PFAM
DUF1785	165	217	4.22e-24	SMART
PAZ	225	360	1.26e-3	SMART
Pfam:ArgoL2	365	412	1.2e-16	PFAM
Pfam:ArgoMid	421	503	8.6e-35	PFAM
Piwi	509	820	2.9e-130	SMART
Blast:Piwi	827	856	2e-9	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Accsl	A	T	2: 93,862,850	V260D	probably damaging	Het
Adora2a	G	A	10: 75,326,179	A51T	probably damaging	Het
Afg1l	G	A	10: 42,438,387	P128S	possibly damaging	Het
Akap11	A	T	14: 78,516,347	N112K		Het
C1ra	A	T	6: 124,517,695	I306F	probably damaging	Het
Ccdc73	A	G	2: 104,991,877	N724D	possibly damaging	Het
Cd248	A	G	19: 5,069,617	I498V	probably benign	Het
Clrn1	A	T	3: 58,884,893	S50T	probably benign	Het
Col7a1	A	G	9: 108,967,025	K1553R	unknown	Het
Cxcr6	A	C	9: 123,810,941	T343P	probably benign	Het
Cyp11b2	T	A	15: 74,856,065	Q56L	probably damaging	Het
Dip2a	A	G	10: 76,278,486		probably null	Het
Dnmbp	A	G	19: 43,849,837	V742A	probably benign	Het
Dusp16	A	T	6: 134,739,769	S192T	probably benign	Het
Ehbp1	A	T	11: 22,232,053	D87E	probably damaging	Het
Fgl1	A	G	8: 41,199,711	V150A	probably benign	Het
Flt3	T	C	5: 147,334,863	D873G	probably damaging	Het
Gart	T	C	16: 91,630,703	D469G	possibly damaging	Het
Gm28168	T	G	1: 117,947,895	S85A	probably benign	Het
Golgb1	A	G	16: 36,915,689	D1807G	probably benign	Het
Grm8	A	G	6: 27,761,352	L291S	probably damaging	Het
Gucy2d	C	T	7: 98,443,469	P18S	possibly damaging	Het
Ifna15	C	T	4: 88,557,761	C162Y	probably damaging	Het
Iqub	C	A	6: 24,479,308	E412*	probably null	Het
Krt4	T	A	15: 101,920,642	D312V		Het
Krtap26-1	A	T	16: 88,647,415	I106N	probably damaging	Het
Krtap26-1	T	C	16: 88,647,436	Y99C	probably damaging	Het
Lipn	T	C	19: 34,084,716	I357T	probably benign	Het
Lrrc14b	A	G	13: 74,363,949	L4P	probably damaging	Het
Mrgpra9	A	T	7: 47,235,293	C209S	probably benign	Het
Myh7b	A	G	2: 155,630,381	N1291D	probably benign	Het
Myo5a	A	G	9: 75,167,046	T746A	probably damaging	Het
Myom2	A	C	8: 15,114,169	E1021D	possibly damaging	Het
Ncoa2	C	T	1: 13,177,185	R338H	probably benign	Het
Ncor2	A	G	5: 125,118,757	F91L		Het
Neb	C	G	2: 52,216,911	A4407P	probably damaging	Het
Olfr1135	T	C	2: 87,671,960	M136V	possibly damaging	Het
Olfr1272	A	G	2: 90,296,012	I283T	probably damaging	Het
Olfr347	A	T	2: 36,735,191	Y290F	probably damaging	Het
Olfr502	T	G	7: 108,523,143	Y269S	probably benign	Het
Olfr74	A	G	2: 87,974,003	F221L	probably benign	Het
Olfr819	C	T	10: 129,965,792	V297M	probably damaging	Het
Peg10	T	TCCC	6: 4,756,451		probably benign	Het
Piwil4	C	A	9: 14,727,475	K298N	probably benign	Het
Prkcz	G	A	4: 155,344,828		probably benign	Het
Prkg2	G	A	5: 98,942,208	P691L	possibly damaging	Het
Ptprc	T	A	1: 138,113,708	K89*	probably null	Het
Rapgef3	C	T	15: 97,766,908	A25T	probably benign	Het
Rreb1	C	T	13: 37,930,516	T617I	probably damaging	Het
Rsph1	A	C	17: 31,273,376	V72G	possibly damaging	Het
Shc2	A	G	10: 79,637,702	V50A	probably benign	Het
Slc38a9	G	A	13: 112,701,487	R262H	probably benign	Het
Slco6c1	T	A	1: 97,128,159	N6Y	possibly damaging	Het
Smarca5	A	G	8: 80,705,332	F886L	probably benign	Het
Tas1r2	A	G	4: 139,653,763		probably benign	Het
Tnrc6c	T	A	11: 117,739,854		probably benign	Het
Trim30b	T	A	7: 104,357,906		probably benign	Het
Trim55	T	C	3: 19,672,962	S398P	probably benign	Het
Ttc39c	T	A	18: 12,686,946		probably benign	Het
Ubxn10	A	G	4: 138,735,867		probably null	Het
Usf3	A	G	16: 44,215,613	N152S	probably benign	Het
Vps13b	T	A	15: 35,533,299	V839E	probably damaging	Het
Zeb1	T	A	18: 5,748,680		probably benign	Het
Zfp780b	T	C	7: 27,963,468	Y554C	probably benign	Het
Zhx2	C	T	15: 57,821,280	T15I	probably damaging	Het

Other mutations in Ago4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00957:Ago4	APN	4	126517133	missense	probably benign	0.01
IGL00965:Ago4	APN	4	126493314	missense	probably benign	0.01
IGL01306:Ago4	APN	4	126515884	splice site	probably null
IGL01943:Ago4	APN	4	126517195	missense	probably damaging	1.00
IGL02079:Ago4	APN	4	126517084	missense	probably damaging	0.99
IGL02117:Ago4	APN	4	126516852	missense	probably benign	0.00
IGL02229:Ago4	APN	4	126511532	missense	probably benign	0.34
IGL02503:Ago4	APN	4	126496805	nonsense	probably null
IGL02504:Ago4	APN	4	126517439	missense	probably benign	0.00
IGL02975:Ago4	APN	4	126512519	critical splice donor site	probably null
BB010:Ago4	UTSW	4	126507018	missense	probably benign	0.22
BB020:Ago4	UTSW	4	126507018	missense	probably benign	0.22
IGL02837:Ago4	UTSW	4	126497300	missense	possibly damaging	0.73
R0129:Ago4	UTSW	4	126517183	missense	possibly damaging	0.85
R0142:Ago4	UTSW	4	126516932	missense	probably benign	0.24
R0480:Ago4	UTSW	4	126526077	missense	probably benign	0.00
R0533:Ago4	UTSW	4	126516860	missense	probably benign	0.00
R1014:Ago4	UTSW	4	126506785	missense	probably damaging	1.00
R1350:Ago4	UTSW	4	126507132	missense	probably benign	0.04
R1547:Ago4	UTSW	4	126511413	missense	probably benign	0.01
R1894:Ago4	UTSW	4	126512600	missense	probably benign	0.11
R1900:Ago4	UTSW	4	126516936	missense	probably benign	0.00
R2510:Ago4	UTSW	4	126517071	missense	probably damaging	1.00
R2511:Ago4	UTSW	4	126517071	missense	probably damaging	1.00
R4063:Ago4	UTSW	4	126515862	intron	probably benign
R4064:Ago4	UTSW	4	126515862	intron	probably benign
R4120:Ago4	UTSW	4	126496807	missense	probably damaging	1.00
R4916:Ago4	UTSW	4	126506842	missense	probably damaging	1.00
R4917:Ago4	UTSW	4	126506842	missense	probably damaging	1.00
R4918:Ago4	UTSW	4	126506842	missense	probably damaging	1.00
R4941:Ago4	UTSW	4	126526054	missense	probably benign	0.00
R5169:Ago4	UTSW	4	126511727	missense	probably benign	0.06
R5262:Ago4	UTSW	4	126496764	missense	possibly damaging	0.66
R5385:Ago4	UTSW	4	126517556	missense	probably benign
R5757:Ago4	UTSW	4	126526084	missense	probably damaging	1.00
R6244:Ago4	UTSW	4	126511487	missense	possibly damaging	0.67
R6256:Ago4	UTSW	4	126520226	missense	probably damaging	1.00
R6389:Ago4	UTSW	4	126507244	missense	probably damaging	1.00
R6545:Ago4	UTSW	4	126512018	missense	probably benign	0.10
R7378:Ago4	UTSW	4	126511464	missense	probably benign
R7804:Ago4	UTSW	4	126512630	missense	probably benign	0.02
R7890:Ago4	UTSW	4	126526076	missense	probably benign	0.00
R7933:Ago4	UTSW	4	126507018	missense	probably benign	0.22
R8852:Ago4	UTSW	4	126493250	missense	probably benign	0.03
R8860:Ago4	UTSW	4	126493250	missense	probably benign	0.03
R9023:Ago4	UTSW	4	126506803	missense	probably damaging	1.00
R9127:Ago4	UTSW	4	126507111	missense	probably damaging	1.00
R9138:Ago4	UTSW	4	126520280	nonsense	probably null
R9447:Ago4	UTSW	4	126508358	missense	probably benign	0.13
X0062:Ago4	UTSW	4	126515941	missense	probably benign	0.00
X0064:Ago4	UTSW	4	126517482	missense	possibly damaging	0.87
Z1176:Ago4	UTSW	4	126520190	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCCAGTAGCAGGAAGGAG -3'
(R):5'- GTGCCACTGTCTTCTTAAATTTGG -3'

Sequencing Primer
(F):5'- CGCTCTGTCAGAGTGCTG -3'
(R):5'- CTTAAATTTGGACAGGCCCTCAGTG -3'

Posted On

2021-07-15