Mutagenetix > Incidental Mutations

Incidental Mutation 'R8830:Hexb'

673768

Institutional Source

Beutler Lab

Gene Symbol

Hexb

Ensembl Gene

ENSMUSG00000021665

Gene Name

hexosaminidase B

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8830 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

97176331-97198357 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 97194254 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 84 (V84I)

Ref Sequence

ENSEMBL: ENSMUSP00000022169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022169]

AlphaFold

P20060

Predicted Effect

probably benign
Transcript: ENSMUST00000022169
AA Change: V84I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022169
Gene: ENSMUSG00000021665
AA Change: V84I

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:Glycohydro_20b2	35	157	7.1e-24	PFAM
Pfam:Glyco_hydro_20	179	496	1.2e-94	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants exhibit spasticity, muscle weakness, rigidity, tremors, and ataxia beginning around 4 months of age and resulting in death about 6 weeks later. Mutants accumulate GM2 ganglioside and glycolipid GA2 in brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	G	A	13: 64,297,300	Q170*	probably null	Het
Abca7	T	A	10: 80,008,971	V1509E	probably damaging	Het
Abraxas2	A	G	7: 132,883,356	D376G	probably damaging	Het
Agbl1	A	G	7: 76,335,311	T159A		Het
Ahnak2	G	A	12: 112,787,036	R89W		Het
Arhgef40	A	C	14: 52,003,708	D1396A	probably damaging	Het
Atp13a5	A	T	16: 29,248,176	F1060I	probably damaging	Het
Atp6v1c1	T	A	15: 38,677,545	F105I	probably damaging	Het
Atp9b	C	T	18: 80,765,800	E635K		Het
BC017643	C	T	11: 121,228,723		probably benign	Het
Brix1	T	A	15: 10,479,596	Q124L	possibly damaging	Het
Cep68	A	G	11: 20,230,418		probably benign	Het
Cfap46	A	G	7: 139,615,649	S2208P	unknown	Het
Crisp1	T	A	17: 40,294,419	K234*	probably null	Het
Cryzl1	C	T	16: 91,712,204	V70I	probably benign	Het
Dnah7b	T	C	1: 46,191,793	Y1404H	probably damaging	Het
Dot1l	A	G	10: 80,771,199	H109R	possibly damaging	Het
E330034G19Rik	A	C	14: 24,309,508	H329P	unknown	Het
Erbb4	A	T	1: 68,075,468	L939Q	probably damaging	Het
Fst	A	T	13: 114,455,828	C118S	probably damaging	Het
Gfra3	A	G	18: 34,711,136	V117A	possibly damaging	Het
Gldc	C	G	19: 30,100,812	M928I	probably benign	Het
Gm5538	A	T	3: 59,747,323	T193S	probably benign	Het
Gm996	T	G	2: 25,577,250	D883A		Het
Greb1	A	G	12: 16,688,519	M1481T	probably benign	Het
Hecw2	G	A	1: 53,891,146	R1045C	probably damaging	Het
Hpse	T	C	5: 100,695,586	E240G	probably benign	Het
Hspa12a	T	C	19: 58,805,463	D322G	possibly damaging	Het
Hspa9	A	T	18: 34,948,104		probably null	Het
Kif9	A	G	9: 110,524,930	K790R	probably damaging	Het
Klc2	C	T	19: 5,110,366		probably null	Het
Ldha	C	G	7: 46,850,278	N144K	probably benign	Het
Micalcl	A	G	7: 112,381,196	T126A	probably benign	Het
Mrpl15	A	T	1: 4,782,584	V137D	probably damaging	Het
Muc16	G	A	9: 18,646,069	T2976I	unknown	Het
Mybpc2	A	T	7: 44,512,541	V495D	probably damaging	Het
Olfr597	A	G	7: 103,321,005	K198R		Het
Olfr713	A	G	7: 107,036,682	N176D	probably benign	Het
Olfr772	A	T	10: 129,174,846	Y58*	probably null	Het
Pcnt	G	A	10: 76,382,174	T2089I	probably benign	Het
Pdzd7	T	C	19: 45,033,073	D563G	probably damaging	Het
Phlpp1	T	G	1: 106,350,603	L915R	probably damaging	Het
Plekhh2	T	A	17: 84,521,803	I34N	probably damaging	Het
Pou6f2	T	A	13: 18,378,498	T84S		Het
Ptprq	A	G	10: 107,586,695	V1612A	possibly damaging	Het
Pvrig	T	G	5: 138,342,148		probably benign	Het
Rasl10b	A	T	11: 83,412,676	I20F	probably damaging	Het
Rimbp3	T	A	16: 17,209,006	V98E	probably damaging	Het
Rims2	T	C	15: 39,437,362	I355T	possibly damaging	Het
Slc1a2	A	G	2: 102,736,015	H30R	probably benign	Het
Slc28a1	G	A	7: 81,161,046	V389M	possibly damaging	Het
Slc7a13	T	C	4: 19,819,189	S130P	probably benign	Het
Sp140	TTTTTTTT	TTTTTTTTTTTTT	1: 85,644,574		probably benign	Het
Spag17	T	A	3: 100,125,435	H2320Q	possibly damaging	Het
Speer4a	T	C	5: 26,036,795	E111G	possibly damaging	Het
Ss18l1	T	C	2: 180,067,338	Y397H	unknown	Het
Tbck	T	C	3: 132,838,057	S890P	probably damaging	Het
Tcp11	T	C	17: 28,080,230	E17G	probably benign	Het
Tesk2	C	T	4: 116,802,287	R315C	probably benign	Het
Tln1	T	C	4: 43,556,383	N45S	probably benign	Het
Trim10	C	T	17: 36,869,954	P26S	probably damaging	Het
Vmac	C	A	17: 56,715,573	G146C	probably damaging	Het
Vmn1r14	G	A	6: 57,234,032	M198I	probably damaging	Het
Vmn1r194	T	C	13: 22,244,836	Y208H	possibly damaging	Het
Vmn1r78	G	A	7: 12,153,191	C243Y	probably damaging	Het
Wasf3	C	T	5: 146,466,862	Q261*	probably null	Het
Ybx2	A	G	11: 69,936,237	K88R	probably benign	Het
Zfhx4	G	A	3: 5,398,889	R1394H	probably damaging	Het
Zfp871	T	C	17: 32,774,927	T425A	probably benign	Het
Zfy2	C	T	Y: 2,106,600	S678N	possibly damaging	Het
Zswim4	T	C	8: 84,223,316	E650G	possibly damaging	Het

Other mutations in Hexb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Hexb	APN	13	97181929	missense	probably damaging	1.00
IGL02010:Hexb	APN	13	97176845	missense	probably benign	0.01
IGL02126:Hexb	APN	13	97178024	missense	possibly damaging	0.93
IGL02303:Hexb	APN	13	97176893	missense	probably damaging	1.00
IGL02955:Hexb	APN	13	97181076	utr 3 prime	probably benign
IGL02988:Hexb	UTSW	13	97198221	missense	unknown
R0311:Hexb	UTSW	13	97183819	unclassified	probably benign
R0470:Hexb	UTSW	13	97177999	missense	probably damaging	0.97
R0520:Hexb	UTSW	13	97181110	missense	probably benign	0.00
R0893:Hexb	UTSW	13	97185627	missense	probably benign	0.02
R1869:Hexb	UTSW	13	97191259	missense	probably benign
R2295:Hexb	UTSW	13	97185612	missense	probably damaging	1.00
R2884:Hexb	UTSW	13	97183700	missense	probably damaging	1.00
R4237:Hexb	UTSW	13	97176751	intron	probably benign
R4238:Hexb	UTSW	13	97176751	intron	probably benign
R4239:Hexb	UTSW	13	97176751	intron	probably benign
R4689:Hexb	UTSW	13	97181092	missense	probably damaging	1.00
R5166:Hexb	UTSW	13	97182004	missense	probably benign	0.13
R6665:Hexb	UTSW	13	97179385	missense	probably benign	0.01
R7379:Hexb	UTSW	13	97181164	missense	probably damaging	1.00
R7553:Hexb	UTSW	13	97198173	missense	probably benign	0.01
R8307:Hexb	UTSW	13	97194199	missense	probably benign	0.02
R8980:Hexb	UTSW	13	97194181	missense	probably damaging	0.99
R9144:Hexb	UTSW	13	97181091	missense	probably damaging	1.00
R9155:Hexb	UTSW	13	97177906	missense	probably damaging	1.00
R9186:Hexb	UTSW	13	97189328	missense	probably damaging	1.00
R9393:Hexb	UTSW	13	97176828	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGAAATGGCAGTGGTTAGTTC -3'
(R):5'- CGGGGTTTTCAGAAGGATCC -3'

Sequencing Primer
(F):5'- GGGTAGTTGCCCTGCCTTC -3'
(R):5'- GTTTTCAGAAGGATCCCCCGAC -3'

Posted On

2021-07-15