Incidental Mutation 'R0731:Actg1'
ID 67583
Institutional Source Beutler Lab
Gene Symbol Actg1
Ensembl Gene ENSMUSG00000062825
Gene Name actin, gamma, cytoplasmic 1
Synonyms E51, Actl
MMRRC Submission 038912-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0731 (G1)
Quality Score 143
Status Validated
Chromosome 11
Chromosomal Location 120236513-120239321 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120237775 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 255 (F255S)
Ref Sequence ENSEMBL: ENSMUSP00000101822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062147] [ENSMUST00000071555] [ENSMUST00000089616] [ENSMUST00000106215] [ENSMUST00000128055] [ENSMUST00000131103]
AlphaFold P63260
Predicted Effect probably benign
Transcript: ENSMUST00000062147
SMART Domains Protein: ENSMUSP00000101821
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
ACTIN 5 153 1.43e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000071555
AA Change: F255S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071486
Gene: ENSMUSG00000062825
AA Change: F255S

DomainStartEndE-ValueType
ACTIN 5 375 2.96e-244 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089616
AA Change: F10S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087043
Gene: ENSMUSG00000062825
AA Change: F10S

DomainStartEndE-ValueType
Pfam:Actin 1 84 3.8e-32 PFAM
Pfam:Actin 78 105 1.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106215
AA Change: F255S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101822
Gene: ENSMUSG00000062825
AA Change: F255S

DomainStartEndE-ValueType
ACTIN 5 375 2.96e-244 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128055
SMART Domains Protein: ENSMUSP00000134296
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
ACTIN 62 268 6.73e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131103
SMART Domains Protein: ENSMUSP00000134070
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
Pfam:Actin 2 124 1.1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143813
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: Actins are highly conserved proteins that are involved in various types of cell motility and maintenance of the cytoskeleton. In vertebrates, three main groups of actin isoforms, alpha, beta, and gamma, have been identified. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton, and as mediators of internal cell motility. Actin, gamma 1, encoded by this gene, is a cytoplasmic actin found in non-muscle cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice in which this gene has been conditionally disrupted in muscle tissue display a reduced mobility and classical hind limb contractures when suspended by the tail. Mice homozygous for a null allele exhibit prenatal lethality, premature death, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,367,247 (GRCm39) R27* probably null Het
Ahdc1 T A 4: 132,790,262 (GRCm39) V501E possibly damaging Het
Alpk2 A T 18: 65,438,461 (GRCm39) D1444E probably damaging Het
Btaf1 T G 19: 36,974,895 (GRCm39) probably null Het
Cacnb2 A G 2: 14,990,517 (GRCm39) H489R possibly damaging Het
Ccdc162 C A 10: 41,455,139 (GRCm39) K398N probably damaging Het
Cd79b G T 11: 106,203,259 (GRCm39) S145R probably damaging Het
Cdh11 T A 8: 103,394,651 (GRCm39) N264Y probably damaging Het
Celsr1 T C 15: 85,785,798 (GRCm39) D2892G probably benign Het
Chuk A G 19: 44,092,205 (GRCm39) probably benign Het
Clk3 T C 9: 57,658,409 (GRCm39) probably benign Het
Dcaf8 A T 1: 172,000,076 (GRCm39) D78V possibly damaging Het
Dctn1 A G 6: 83,160,071 (GRCm39) T87A probably damaging Het
Ddx50 T C 10: 62,452,028 (GRCm39) N732D unknown Het
Dnah5 A T 15: 28,311,289 (GRCm39) Y1756F possibly damaging Het
Dock3 A T 9: 106,847,055 (GRCm39) V858E probably damaging Het
Fer1l4 A G 2: 155,865,990 (GRCm39) F1566S probably benign Het
Fpr-rs7 T C 17: 20,334,116 (GRCm39) I125V probably benign Het
Fuca2 C T 10: 13,381,771 (GRCm39) P228L probably benign Het
Galntl6 A G 8: 58,989,018 (GRCm39) F57L probably benign Het
Gigyf2 T A 1: 87,335,449 (GRCm39) probably benign Het
Gm16505 A T 13: 3,411,329 (GRCm39) noncoding transcript Het
Gm4781 T C 10: 100,232,639 (GRCm39) noncoding transcript Het
Gm9956 T A 10: 56,621,639 (GRCm39) Y100* probably null Het
Gpr137c T A 14: 45,483,806 (GRCm39) C178S probably damaging Het
Gpr83 A G 9: 14,779,940 (GRCm39) R331G probably benign Het
Hlcs T A 16: 93,932,711 (GRCm39) H851L probably damaging Het
Irag1 T C 7: 110,476,107 (GRCm39) S615G probably benign Het
Kbtbd6 C A 14: 79,689,324 (GRCm39) Y6* probably null Het
Kif23 T C 9: 61,832,314 (GRCm39) R610G possibly damaging Het
Kifc3 G A 8: 95,832,361 (GRCm39) T487I probably damaging Het
Klra5 A C 6: 129,885,759 (GRCm39) D133E possibly damaging Het
Klra6 T C 6: 129,999,668 (GRCm39) E100G probably damaging Het
Klre1 T A 6: 129,562,531 (GRCm39) probably benign Het
Lancl1 C T 1: 67,049,069 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Man1b1 A G 2: 25,228,167 (GRCm39) I146V possibly damaging Het
Map4k5 T A 12: 69,921,038 (GRCm39) probably benign Het
Mast3 A G 8: 71,233,965 (GRCm39) S178P probably damaging Het
Mau2 A G 8: 70,476,262 (GRCm39) probably null Het
Mgat4f A C 1: 134,317,713 (GRCm39) M162L probably benign Het
Mkrn2 A T 6: 115,591,612 (GRCm39) N312Y probably damaging Het
Myh1 A G 11: 67,093,359 (GRCm39) E150G probably damaging Het
Myo7b T A 18: 32,094,878 (GRCm39) probably null Het
Nyap1 A G 5: 137,733,560 (GRCm39) V491A probably damaging Het
Or10a3 A T 7: 108,480,740 (GRCm39) N24K probably damaging Het
Or4g17 A G 2: 111,209,638 (GRCm39) M98V probably damaging Het
Or5p60 T C 7: 107,723,941 (GRCm39) I176M probably benign Het
Or8g34 T C 9: 39,372,828 (GRCm39) F34L probably damaging Het
Oxsm A T 14: 16,240,893 (GRCm38) H385Q probably damaging Het
Pbld2 T C 10: 62,892,590 (GRCm39) S242P probably damaging Het
Pdzd7 T C 19: 45,017,744 (GRCm39) Y675C probably damaging Het
Pnkd T A 1: 74,390,700 (GRCm39) H266Q probably damaging Het
Rbfox2 A G 15: 76,983,479 (GRCm39) S141P probably benign Het
Rdx A G 9: 51,979,518 (GRCm39) T214A probably benign Het
Ripor2 A T 13: 24,864,627 (GRCm39) E219V probably damaging Het
Rlig1 T C 10: 100,422,065 (GRCm39) T66A probably damaging Het
Rufy2 G A 10: 62,847,623 (GRCm39) probably benign Het
Slf2 T A 19: 44,964,165 (GRCm39) probably benign Het
Snrnp200 G T 2: 127,068,065 (GRCm39) probably benign Het
Snx7 T A 3: 117,623,320 (GRCm39) probably benign Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Tacr3 G A 3: 134,560,761 (GRCm39) probably null Het
Tcerg1 C T 18: 42,704,905 (GRCm39) T978M probably damaging Het
Tcf7l1 G T 6: 72,765,252 (GRCm39) P126Q possibly damaging Het
Trank1 A G 9: 111,194,556 (GRCm39) D860G probably damaging Het
Try4 T C 6: 41,281,301 (GRCm39) L81P probably benign Het
Ucp1 T C 8: 84,024,476 (GRCm39) probably benign Het
Ugt2b38 G A 5: 87,568,311 (GRCm39) A328V probably damaging Het
Wfikkn1 T A 17: 26,096,991 (GRCm39) R444S probably damaging Het
Zfc3h1 A G 10: 115,246,537 (GRCm39) T875A probably benign Het
Zfp11 A G 5: 129,734,328 (GRCm39) S378P probably damaging Het
Zfp984 T A 4: 147,840,689 (GRCm39) N54I probably damaging Het
Other mutations in Actg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2015:Actg1 UTSW 11 120,237,636 (GRCm39) missense possibly damaging 0.95
R2860:Actg1 UTSW 11 120,237,627 (GRCm39) missense probably benign 0.03
R2861:Actg1 UTSW 11 120,237,627 (GRCm39) missense probably benign 0.03
R2862:Actg1 UTSW 11 120,237,627 (GRCm39) missense probably benign 0.03
R4473:Actg1 UTSW 11 120,239,085 (GRCm39) missense probably benign 0.01
R4732:Actg1 UTSW 11 120,238,305 (GRCm39) splice site probably benign
R5004:Actg1 UTSW 11 120,238,986 (GRCm39) intron probably benign
R5026:Actg1 UTSW 11 120,237,784 (GRCm39) missense probably damaging 1.00
R5060:Actg1 UTSW 11 120,237,839 (GRCm39) missense probably benign 0.10
R5216:Actg1 UTSW 11 120,238,580 (GRCm39) missense probably damaging 0.98
R6328:Actg1 UTSW 11 120,238,586 (GRCm39) missense possibly damaging 0.90
R6660:Actg1 UTSW 11 120,237,581 (GRCm39) missense probably damaging 1.00
R6888:Actg1 UTSW 11 120,238,141 (GRCm39) missense probably damaging 1.00
R8461:Actg1 UTSW 11 120,239,010 (GRCm39) missense unknown
R8488:Actg1 UTSW 11 120,238,517 (GRCm39) missense possibly damaging 0.52
R9033:Actg1 UTSW 11 120,237,826 (GRCm39) missense probably benign 0.09
R9189:Actg1 UTSW 11 120,239,013 (GRCm39) missense unknown
Z1177:Actg1 UTSW 11 120,238,935 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATGAGCACTCATGCCCTTCCTG -3'
(R):5'- CCACCACTGCTGAGAGGGAAATTG -3'

Sequencing Primer
(F):5'- AGCACTGTATTGGCATACAGGTC -3'
(R):5'- CTGAGAGGGAAATTGTTCGTGAC -3'
Posted On 2013-09-03