Incidental Mutation 'R8993:Arhgef16'
ID 684530
Institutional Source Beutler Lab
Gene Symbol Arhgef16
Ensembl Gene ENSMUSG00000029032
Gene Name Rho guanine nucleotide exchange factor (GEF) 16
Synonyms Neuroblastoma
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 154278486-154301676 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 154287038 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 233 (E233K)
Ref Sequence ENSEMBL: ENSMUSP00000030898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030898] [ENSMUST00000152947] [ENSMUST00000154895] [ENSMUST00000169623]
AlphaFold Q3U5C8
Predicted Effect probably damaging
Transcript: ENSMUST00000030898
AA Change: E233K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030898
Gene: ENSMUSG00000029032
AA Change: E233K

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
RhoGEF 292 471 5.9e-52 SMART
PH 506 626 6.46e-8 SMART
SH3 636 692 2.31e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152947
SMART Domains Protein: ENSMUSP00000119398
Gene: ENSMUSG00000029032

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000154895
SMART Domains Protein: ENSMUSP00000121273
Gene: ENSMUSG00000029032

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169623
AA Change: E233K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126296
Gene: ENSMUSG00000029032
AA Change: E233K

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
RhoGEF 292 471 5.9e-52 SMART
PH 506 626 6.46e-8 SMART
SH3 636 692 2.31e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Although the specific function of this protein is not known yet, it is thought to be involved in protein-protein and protein-lipid interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Adcy4 T C 14: 55,771,378 E864G probably null Het
Adcy4 T C 14: 55,778,699 D387G probably damaging Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Arhgef16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Arhgef16 APN 4 154280244 missense probably benign 0.01
IGL02422:Arhgef16 APN 4 154287065 nonsense probably null
IGL02801:Arhgef16 APN 4 154291507 missense probably damaging 0.99
IGL02928:Arhgef16 APN 4 154282893 missense probably benign 0.00
R0518:Arhgef16 UTSW 4 154291034 missense probably damaging 0.99
R1148:Arhgef16 UTSW 4 154280889 missense probably benign 0.05
R1148:Arhgef16 UTSW 4 154280889 missense probably benign 0.05
R1576:Arhgef16 UTSW 4 154291312 missense probably damaging 1.00
R1778:Arhgef16 UTSW 4 154287986 missense probably benign 0.17
R1853:Arhgef16 UTSW 4 154291106 missense probably benign 0.14
R1912:Arhgef16 UTSW 4 154280323 splice site probably null
R2269:Arhgef16 UTSW 4 154285033 missense probably damaging 0.98
R4437:Arhgef16 UTSW 4 154279696 critical splice donor site probably null
R4690:Arhgef16 UTSW 4 154287963 splice site probably null
R5174:Arhgef16 UTSW 4 154282047 missense probably damaging 1.00
R5566:Arhgef16 UTSW 4 154285648 missense probably benign 0.01
R6348:Arhgef16 UTSW 4 154287083 missense probably benign 0.18
R7264:Arhgef16 UTSW 4 154280930 missense probably damaging 1.00
R7469:Arhgef16 UTSW 4 154291306 missense probably damaging 1.00
R7626:Arhgef16 UTSW 4 154282882 missense possibly damaging 0.89
R7651:Arhgef16 UTSW 4 154291067 missense probably damaging 1.00
R7684:Arhgef16 UTSW 4 154281828 missense possibly damaging 0.62
R7759:Arhgef16 UTSW 4 154286975 missense probably benign 0.00
R8334:Arhgef16 UTSW 4 154282767 nonsense probably null
R8995:Arhgef16 UTSW 4 154287038 missense probably damaging 1.00
R9141:Arhgef16 UTSW 4 154281843 missense probably damaging 1.00
R9256:Arhgef16 UTSW 4 154279045 nonsense probably null
R9266:Arhgef16 UTSW 4 154291465 missense probably benign 0.14
R9426:Arhgef16 UTSW 4 154281843 missense probably damaging 1.00
Z1177:Arhgef16 UTSW 4 154281453 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCTCTAAAATCTGTTAAGGGC -3'
(R):5'- TGCTACACTCTTCCAGGCTG -3'

Sequencing Primer
(F):5'- CTCTAAAATCTGTTAAGGGCCTGAGC -3'
(R):5'- ACTCTTCCAGGCTGGCTGTG -3'
Posted On 2021-10-11