Mutagenetix > Incidental Mutations

Incidental Mutation 'R8993:Adcy4'

684565

Institutional Source

Beutler Lab

Gene Symbol

Adcy4

Ensembl Gene

ENSMUSG00000022220

Gene Name

adenylate cyclase 4

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55769057-55784095 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55771378 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 864 (E864G)

Ref Sequence

ENSEMBL: ENSMUSP00000002398 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000057569] [ENSMUST00000170223]

AlphaFold

Q91WF3

Predicted Effect

probably null
Transcript: ENSMUST00000002398
AA Change: E864G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220
AA Change: E864G

Domain	Start	End	E-Value	Type
low complexity region	28	48	N/A	INTRINSIC
low complexity region	66	80	N/A	INTRINSIC
low complexity region	145	161	N/A	INTRINSIC
CYCc	218	426	1.56e-62	SMART
Pfam:DUF1053	479	581	2.4e-35	PFAM
transmembrane domain	607	629	N/A	INTRINSIC
transmembrane domain	661	683	N/A	INTRINSIC
transmembrane domain	717	739	N/A	INTRINSIC
transmembrane domain	746	768	N/A	INTRINSIC
transmembrane domain	792	809	N/A	INTRINSIC
CYCc	835	1057	4.46e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000057569

SMART Domains

Protein: ENSMUSP00000051368
Gene: ENSMUSG00000046908

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	28	196	7.4e-7	PFAM
Pfam:7TM_GPCR_Srsx	31	249	2e-8	PFAM
Pfam:7tm_1	37	285	1.3e-42	PFAM
Pfam:Serpentine_r_xa	54	201	2.8e-4	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170223
AA Change: E864G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220
AA Change: E864G

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC
transmembrane domain	61	80	N/A	INTRINSIC
transmembrane domain	92	114	N/A	INTRINSIC
transmembrane domain	119	138	N/A	INTRINSIC
transmembrane domain	145	162	N/A	INTRINSIC
transmembrane domain	172	194	N/A	INTRINSIC
CYCc	218	426	1.56e-62	SMART
Pfam:DUF1053	479	581	1.6e-24	PFAM
transmembrane domain	607	629	N/A	INTRINSIC
transmembrane domain	661	683	N/A	INTRINSIC
transmembrane domain	717	739	N/A	INTRINSIC
transmembrane domain	746	768	N/A	INTRINSIC
transmembrane domain	792	809	N/A	INTRINSIC
CYCc	835	1057	4.46e-40	SMART

Meta Mutation Damage Score

0.4111

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700069L16Rik	A	T	5: 113,703,781	C92*	probably null	Het
A830018L16Rik	G	T	1: 11,545,267	E155*	probably null	Het
Acaa1a	A	T	9: 119,349,352		probably null	Het
Ank1	C	T	8: 23,098,939	H574Y	probably damaging	Het
Arhgef16	C	T	4: 154,287,038	E233K	probably damaging	Het
Arhgef26	A	T	3: 62,448,104	Y699F	probably benign	Het
BB014433	C	T	8: 15,042,101	V251M	probably damaging	Het
Bcan	G	A	3: 87,994,222	A391V	probably benign	Het
Bod1l	A	C	5: 41,816,867	V2368G	probably benign	Het
Braf	A	G	6: 39,662,151	V222A	probably damaging	Het
Cd33	G	T	7: 43,533,447		probably benign	Het
Cdkl2	T	A	5: 92,022,151	K324N	probably damaging	Het
Celf6	A	T	9: 59,602,871	T199S	probably damaging	Het
Cmtm4	A	C	8: 104,355,166	D196E	probably benign	Het
Cntn1	G	A	15: 92,234,466	V148M	probably damaging	Het
Col1a2	C	A	6: 4,535,451	P921H	unknown	Het
Crmp1	T	C	5: 37,242,146	M1T	probably null	Het
Dnah7a	A	T	1: 53,504,103	Y2303N	probably damaging	Het
Dock10	G	T	1: 80,574,171	T650K	probably benign	Het
Fam24a	A	G	7: 131,336,540	D53G	probably benign	Het
Foxa2	A	T	2: 148,044,706	M69K	probably benign	Het
Gatad2a	T	A	8: 69,909,935	H601L	probably damaging	Het
Gimap4	A	C	6: 48,690,605	D98A	probably damaging	Het
Gm14295	G	T	2: 176,809,830	R371L	possibly damaging	Het
Gm5039	A	G	12: 88,321,400	F28L	probably benign	Het
Golim4	G	T	3: 75,878,128	A652E	probably benign	Het
Grid1	A	G	14: 35,026,942	I240V	probably benign	Het
Iqsec3	T	A	6: 121,413,313	T400S	unknown	Het
Itk	G	A	11: 46,334,908	R539C	probably damaging	Het
Kdelc1	G	T	1: 44,112,764	L322I	possibly damaging	Het
Kif27	T	A	13: 58,326,098	D695V	possibly damaging	Het
Krt79	T	C	15: 101,931,006		probably benign	Het
Lama2	C	A	10: 27,422,714	V129L	possibly damaging	Het
Lonrf1	C	A	8: 36,229,238	E552D	possibly damaging	Het
Mpp3	A	G	11: 102,000,665	I549T	probably benign	Het
Nat1	T	C	8: 67,491,742	Y260H	probably benign	Het
Nipal2	T	A	15: 34,648,837	K69*	probably null	Het
Nlrx1	G	T	9: 44,256,941		probably benign	Het
Pde1b	C	A	15: 103,521,425	A115E	probably benign	Het
Pde4dip	A	G	3: 97,766,494	Y369H	probably damaging	Het
Pnpla7	A	G	2: 25,053,419	Y1286C	possibly damaging	Het
Pramel5	T	C	4: 144,272,959	E186G	possibly damaging	Het
Qdpr	C	T	5: 45,450,044	G20D	probably damaging	Het
Rmnd1	T	G	10: 4,407,918	I364L	probably benign	Het
Slc5a4a	A	T	10: 76,186,535	E568V	probably benign	Het
Slc6a18	T	A	13: 73,668,271	I330F	probably benign	Het
Spesp1	T	C	9: 62,273,270	T119A	possibly damaging	Het
Sypl	G	A	12: 32,975,663	S242N	probably benign	Het
Tbx18	G	A	9: 87,730,717	T43M	probably benign	Het
Tm7sf2	T	A	19: 6,063,926	D263V	probably damaging	Het
Trbv21	T	C	6: 41,202,990	I80T	probably damaging	Het
Ttc3	T	A	16: 94,427,808	L747Q	possibly damaging	Het
Ttll11	T	C	2: 35,817,801	D498G	possibly damaging	Het
Ttn	T	C	2: 76,753,370	Y22431C	probably null	Het
Ubtfl1	T	A	9: 18,410,341	S388R		Het
Vmn2r118	A	T	17: 55,610,835	L226I	possibly damaging	Het
Wdr46	A	G	17: 33,949,182	H576R	probably benign	Het
Zfp426	A	G	9: 20,475,000	F62L	probably damaging	Het

Other mutations in Adcy4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00917:Adcy4	APN	14	55773663	splice site	probably null
IGL02406:Adcy4	APN	14	55770047	missense	possibly damaging	0.45
IGL02503:Adcy4	APN	14	55771505	missense	probably damaging	1.00
IGL02543:Adcy4	APN	14	55769170	missense	probably benign
IGL02616:Adcy4	APN	14	55783514	splice site	probably null
IGL03002:Adcy4	APN	14	55773556	missense	probably benign	0.31
IGL03026:Adcy4	APN	14	55778010	missense	probably damaging	1.00
IGL03190:Adcy4	APN	14	55779053	missense	probably damaging	1.00
IGL03247:Adcy4	APN	14	55770096	missense	probably damaging	1.00
stressed	UTSW	14	55779099	splice site	probably null
IGL03098:Adcy4	UTSW	14	55781581	missense	probably null	0.82
R0098:Adcy4	UTSW	14	55769827	missense	possibly damaging	0.78
R0102:Adcy4	UTSW	14	55771533	missense	probably benign	0.29
R0396:Adcy4	UTSW	14	55772288	missense	probably benign	0.00
R0482:Adcy4	UTSW	14	55774572	critical splice acceptor site	probably null
R0634:Adcy4	UTSW	14	55781597	missense	probably benign
R0691:Adcy4	UTSW	14	55772647	splice site	probably benign
R0704:Adcy4	UTSW	14	55772756	missense	probably benign
R0815:Adcy4	UTSW	14	55783599	missense	probably damaging	1.00
R0863:Adcy4	UTSW	14	55783599	missense	probably damaging	1.00
R1446:Adcy4	UTSW	14	55770023	critical splice donor site	probably null
R1462:Adcy4	UTSW	14	55778308	missense	possibly damaging	0.78
R1462:Adcy4	UTSW	14	55778308	missense	possibly damaging	0.78
R1463:Adcy4	UTSW	14	55778939	missense	probably damaging	1.00
R1624:Adcy4	UTSW	14	55781927	missense	possibly damaging	0.68
R1799:Adcy4	UTSW	14	55771472	missense	probably benign	0.01
R1878:Adcy4	UTSW	14	55769905	missense	probably damaging	0.96
R2007:Adcy4	UTSW	14	55778313	missense	possibly damaging	0.45
R2156:Adcy4	UTSW	14	55769170	missense	probably benign	0.09
R2425:Adcy4	UTSW	14	55778017	missense	probably damaging	0.99
R2517:Adcy4	UTSW	14	55781946	missense	probably damaging	1.00
R3882:Adcy4	UTSW	14	55774546	missense	probably benign	0.27
R4021:Adcy4	UTSW	14	55775178	splice site	probably null
R4022:Adcy4	UTSW	14	55775178	splice site	probably null
R4411:Adcy4	UTSW	14	55769443	missense	probably damaging	1.00
R4530:Adcy4	UTSW	14	55779028	missense	probably damaging	1.00
R4560:Adcy4	UTSW	14	55778950	splice site	probably null
R4704:Adcy4	UTSW	14	55775025	missense	possibly damaging	0.91
R4780:Adcy4	UTSW	14	55775036	missense	probably benign	0.07
R4860:Adcy4	UTSW	14	55781927	missense	possibly damaging	0.68
R4860:Adcy4	UTSW	14	55781927	missense	possibly damaging	0.68
R4868:Adcy4	UTSW	14	55773722	missense	probably benign
R4890:Adcy4	UTSW	14	55779029	missense	probably damaging	1.00
R4920:Adcy4	UTSW	14	55779029	missense	probably damaging	1.00
R4948:Adcy4	UTSW	14	55779029	missense	probably damaging	1.00
R4952:Adcy4	UTSW	14	55779029	missense	probably damaging	1.00
R4953:Adcy4	UTSW	14	55779029	missense	probably damaging	1.00
R4987:Adcy4	UTSW	14	55773477	missense	probably benign	0.01
R4991:Adcy4	UTSW	14	55773465	missense	probably benign	0.03
R5080:Adcy4	UTSW	14	55772375	missense	probably damaging	0.98
R5620:Adcy4	UTSW	14	55772367	nonsense	probably null
R5652:Adcy4	UTSW	14	55773443	missense	probably benign
R5726:Adcy4	UTSW	14	55783661	missense	probably damaging	1.00
R5910:Adcy4	UTSW	14	55779013	missense	probably damaging	1.00
R5958:Adcy4	UTSW	14	55779099	splice site	probably null
R6280:Adcy4	UTSW	14	55779043	missense	probably damaging	1.00
R6318:Adcy4	UTSW	14	55769224	missense	probably damaging	1.00
R6598:Adcy4	UTSW	14	55770045	missense	probably benign	0.03
R6947:Adcy4	UTSW	14	55778391	missense	possibly damaging	0.92
R7012:Adcy4	UTSW	14	55779919	missense	possibly damaging	0.95
R7147:Adcy4	UTSW	14	55779725	missense	probably damaging	1.00
R7386:Adcy4	UTSW	14	55778327	missense	probably damaging	1.00
R7414:Adcy4	UTSW	14	55781633	missense	probably benign	0.15
R7431:Adcy4	UTSW	14	55772672	missense	probably benign	0.01
R7490:Adcy4	UTSW	14	55770433	missense	possibly damaging	0.66
R7552:Adcy4	UTSW	14	55773465	missense	probably benign	0.00
R7672:Adcy4	UTSW	14	55780905	missense	probably benign	0.14
R8003:Adcy4	UTSW	14	55781635	missense	probably benign	0.00
R8042:Adcy4	UTSW	14	55775239	missense	probably benign	0.01
R8100:Adcy4	UTSW	14	55772265	nonsense	probably null
R8343:Adcy4	UTSW	14	55775240	missense	probably benign	0.02
R8801:Adcy4	UTSW	14	55771995	missense	probably benign	0.05
R8811:Adcy4	UTSW	14	55772764	missense	probably benign
R8993:Adcy4	UTSW	14	55778699	missense	probably damaging	1.00
R9026:Adcy4	UTSW	14	55778969	missense	probably damaging	1.00
X0025:Adcy4	UTSW	14	55770391	missense	probably damaging	1.00
Z1088:Adcy4	UTSW	14	55780956	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGGTCACCAAGAACAAAGTCCG -3'
(R):5'- GCTCCAGGACAGTTGTACCTTG -3'

Sequencing Primer
(F):5'- GTCCGAGACTATGCTCTGACAAG -3'
(R):5'- ACCTTGAACCTATGTCTAAGCTGGG -3'

Posted On

2021-10-11