Incidental Mutation 'R8993:Adcy4'
ID 684565
Institutional Source Beutler Lab
Gene Symbol Adcy4
Ensembl Gene ENSMUSG00000022220
Gene Name adenylate cyclase 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8993 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 55769057-55784095 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55771378 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 864 (E864G)
Ref Sequence ENSEMBL: ENSMUSP00000002398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000057569] [ENSMUST00000170223]
AlphaFold Q91WF3
Predicted Effect probably null
Transcript: ENSMUST00000002398
AA Change: E864G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220
AA Change: E864G

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057569
SMART Domains Protein: ENSMUSP00000051368
Gene: ENSMUSG00000046908

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 28 196 7.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 31 249 2e-8 PFAM
Pfam:7tm_1 37 285 1.3e-42 PFAM
Pfam:Serpentine_r_xa 54 201 2.8e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170223
AA Change: E864G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220
AA Change: E864G

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Meta Mutation Damage Score 0.4111 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,703,781 C92* probably null Het
A830018L16Rik G T 1: 11,545,267 E155* probably null Het
Acaa1a A T 9: 119,349,352 probably null Het
Ank1 C T 8: 23,098,939 H574Y probably damaging Het
Arhgef16 C T 4: 154,287,038 E233K probably damaging Het
Arhgef26 A T 3: 62,448,104 Y699F probably benign Het
BB014433 C T 8: 15,042,101 V251M probably damaging Het
Bcan G A 3: 87,994,222 A391V probably benign Het
Bod1l A C 5: 41,816,867 V2368G probably benign Het
Braf A G 6: 39,662,151 V222A probably damaging Het
Cd33 G T 7: 43,533,447 probably benign Het
Cdkl2 T A 5: 92,022,151 K324N probably damaging Het
Celf6 A T 9: 59,602,871 T199S probably damaging Het
Cmtm4 A C 8: 104,355,166 D196E probably benign Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Col1a2 C A 6: 4,535,451 P921H unknown Het
Crmp1 T C 5: 37,242,146 M1T probably null Het
Dnah7a A T 1: 53,504,103 Y2303N probably damaging Het
Dock10 G T 1: 80,574,171 T650K probably benign Het
Fam24a A G 7: 131,336,540 D53G probably benign Het
Foxa2 A T 2: 148,044,706 M69K probably benign Het
Gatad2a T A 8: 69,909,935 H601L probably damaging Het
Gimap4 A C 6: 48,690,605 D98A probably damaging Het
Gm14295 G T 2: 176,809,830 R371L possibly damaging Het
Gm5039 A G 12: 88,321,400 F28L probably benign Het
Golim4 G T 3: 75,878,128 A652E probably benign Het
Grid1 A G 14: 35,026,942 I240V probably benign Het
Iqsec3 T A 6: 121,413,313 T400S unknown Het
Itk G A 11: 46,334,908 R539C probably damaging Het
Kdelc1 G T 1: 44,112,764 L322I possibly damaging Het
Kif27 T A 13: 58,326,098 D695V possibly damaging Het
Krt79 T C 15: 101,931,006 probably benign Het
Lama2 C A 10: 27,422,714 V129L possibly damaging Het
Lonrf1 C A 8: 36,229,238 E552D possibly damaging Het
Mpp3 A G 11: 102,000,665 I549T probably benign Het
Nat1 T C 8: 67,491,742 Y260H probably benign Het
Nipal2 T A 15: 34,648,837 K69* probably null Het
Nlrx1 G T 9: 44,256,941 probably benign Het
Pde1b C A 15: 103,521,425 A115E probably benign Het
Pde4dip A G 3: 97,766,494 Y369H probably damaging Het
Pnpla7 A G 2: 25,053,419 Y1286C possibly damaging Het
Pramel5 T C 4: 144,272,959 E186G possibly damaging Het
Qdpr C T 5: 45,450,044 G20D probably damaging Het
Rmnd1 T G 10: 4,407,918 I364L probably benign Het
Slc5a4a A T 10: 76,186,535 E568V probably benign Het
Slc6a18 T A 13: 73,668,271 I330F probably benign Het
Spesp1 T C 9: 62,273,270 T119A possibly damaging Het
Sypl G A 12: 32,975,663 S242N probably benign Het
Tbx18 G A 9: 87,730,717 T43M probably benign Het
Tm7sf2 T A 19: 6,063,926 D263V probably damaging Het
Trbv21 T C 6: 41,202,990 I80T probably damaging Het
Ttc3 T A 16: 94,427,808 L747Q possibly damaging Het
Ttll11 T C 2: 35,817,801 D498G possibly damaging Het
Ttn T C 2: 76,753,370 Y22431C probably null Het
Ubtfl1 T A 9: 18,410,341 S388R Het
Vmn2r118 A T 17: 55,610,835 L226I possibly damaging Het
Wdr46 A G 17: 33,949,182 H576R probably benign Het
Zfp426 A G 9: 20,475,000 F62L probably damaging Het
Other mutations in Adcy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Adcy4 APN 14 55773663 splice site probably null
IGL02406:Adcy4 APN 14 55770047 missense possibly damaging 0.45
IGL02503:Adcy4 APN 14 55771505 missense probably damaging 1.00
IGL02543:Adcy4 APN 14 55769170 missense probably benign
IGL02616:Adcy4 APN 14 55783514 splice site probably null
IGL03002:Adcy4 APN 14 55773556 missense probably benign 0.31
IGL03026:Adcy4 APN 14 55778010 missense probably damaging 1.00
IGL03190:Adcy4 APN 14 55779053 missense probably damaging 1.00
IGL03247:Adcy4 APN 14 55770096 missense probably damaging 1.00
stressed UTSW 14 55779099 splice site probably null
IGL03098:Adcy4 UTSW 14 55781581 missense probably null 0.82
R0098:Adcy4 UTSW 14 55769827 missense possibly damaging 0.78
R0102:Adcy4 UTSW 14 55771533 missense probably benign 0.29
R0396:Adcy4 UTSW 14 55772288 missense probably benign 0.00
R0482:Adcy4 UTSW 14 55774572 critical splice acceptor site probably null
R0634:Adcy4 UTSW 14 55781597 missense probably benign
R0691:Adcy4 UTSW 14 55772647 splice site probably benign
R0704:Adcy4 UTSW 14 55772756 missense probably benign
R0815:Adcy4 UTSW 14 55783599 missense probably damaging 1.00
R0863:Adcy4 UTSW 14 55783599 missense probably damaging 1.00
R1446:Adcy4 UTSW 14 55770023 critical splice donor site probably null
R1462:Adcy4 UTSW 14 55778308 missense possibly damaging 0.78
R1462:Adcy4 UTSW 14 55778308 missense possibly damaging 0.78
R1463:Adcy4 UTSW 14 55778939 missense probably damaging 1.00
R1624:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R1799:Adcy4 UTSW 14 55771472 missense probably benign 0.01
R1878:Adcy4 UTSW 14 55769905 missense probably damaging 0.96
R2007:Adcy4 UTSW 14 55778313 missense possibly damaging 0.45
R2156:Adcy4 UTSW 14 55769170 missense probably benign 0.09
R2425:Adcy4 UTSW 14 55778017 missense probably damaging 0.99
R2517:Adcy4 UTSW 14 55781946 missense probably damaging 1.00
R3882:Adcy4 UTSW 14 55774546 missense probably benign 0.27
R4021:Adcy4 UTSW 14 55775178 splice site probably null
R4022:Adcy4 UTSW 14 55775178 splice site probably null
R4411:Adcy4 UTSW 14 55769443 missense probably damaging 1.00
R4530:Adcy4 UTSW 14 55779028 missense probably damaging 1.00
R4560:Adcy4 UTSW 14 55778950 splice site probably null
R4704:Adcy4 UTSW 14 55775025 missense possibly damaging 0.91
R4780:Adcy4 UTSW 14 55775036 missense probably benign 0.07
R4860:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R4860:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R4868:Adcy4 UTSW 14 55773722 missense probably benign
R4890:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4920:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4948:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4952:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4953:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4987:Adcy4 UTSW 14 55773477 missense probably benign 0.01
R4991:Adcy4 UTSW 14 55773465 missense probably benign 0.03
R5080:Adcy4 UTSW 14 55772375 missense probably damaging 0.98
R5620:Adcy4 UTSW 14 55772367 nonsense probably null
R5652:Adcy4 UTSW 14 55773443 missense probably benign
R5726:Adcy4 UTSW 14 55783661 missense probably damaging 1.00
R5910:Adcy4 UTSW 14 55779013 missense probably damaging 1.00
R5958:Adcy4 UTSW 14 55779099 splice site probably null
R6280:Adcy4 UTSW 14 55779043 missense probably damaging 1.00
R6318:Adcy4 UTSW 14 55769224 missense probably damaging 1.00
R6598:Adcy4 UTSW 14 55770045 missense probably benign 0.03
R6947:Adcy4 UTSW 14 55778391 missense possibly damaging 0.92
R7012:Adcy4 UTSW 14 55779919 missense possibly damaging 0.95
R7147:Adcy4 UTSW 14 55779725 missense probably damaging 1.00
R7386:Adcy4 UTSW 14 55778327 missense probably damaging 1.00
R7414:Adcy4 UTSW 14 55781633 missense probably benign 0.15
R7431:Adcy4 UTSW 14 55772672 missense probably benign 0.01
R7490:Adcy4 UTSW 14 55770433 missense possibly damaging 0.66
R7552:Adcy4 UTSW 14 55773465 missense probably benign 0.00
R7672:Adcy4 UTSW 14 55780905 missense probably benign 0.14
R8003:Adcy4 UTSW 14 55781635 missense probably benign 0.00
R8042:Adcy4 UTSW 14 55775239 missense probably benign 0.01
R8100:Adcy4 UTSW 14 55772265 nonsense probably null
R8343:Adcy4 UTSW 14 55775240 missense probably benign 0.02
R8801:Adcy4 UTSW 14 55771995 missense probably benign 0.05
R8811:Adcy4 UTSW 14 55772764 missense probably benign
R8993:Adcy4 UTSW 14 55778699 missense probably damaging 1.00
R9026:Adcy4 UTSW 14 55778969 missense probably damaging 1.00
X0025:Adcy4 UTSW 14 55770391 missense probably damaging 1.00
Z1088:Adcy4 UTSW 14 55780956 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGTCACCAAGAACAAAGTCCG -3'
(R):5'- GCTCCAGGACAGTTGTACCTTG -3'

Sequencing Primer
(F):5'- GTCCGAGACTATGCTCTGACAAG -3'
(R):5'- ACCTTGAACCTATGTCTAAGCTGGG -3'
Posted On 2021-10-11