Incidental Mutation 'R9221:Myo1d'
ID 699479
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Name myosin ID
Synonyms D11Ertd9e, 9930104H07Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9221 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 80372952-80670851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80565744 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 360 (N360K)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
AlphaFold Q5SYD0
Predicted Effect probably damaging
Transcript: ENSMUST00000041065
AA Change: N360K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: N360K

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070997
AA Change: N360K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: N360K

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,921,828 (GRCm39) D1128G probably damaging Het
Acsm3 A T 7: 119,368,131 (GRCm39) R116* probably null Het
Acte1 G T 7: 143,434,902 (GRCm39) probably null Het
Ahnak T A 19: 8,989,943 (GRCm39) D3742E probably damaging Het
Arhgef17 A G 7: 100,528,818 (GRCm39) S598P possibly damaging Het
Asxl2 T C 12: 3,552,310 (GRCm39) F1351L probably damaging Het
Atg7 C T 6: 114,672,588 (GRCm39) T267I possibly damaging Het
Bace2 A G 16: 97,209,692 (GRCm39) K202R probably benign Het
Bccip G T 7: 133,311,249 (GRCm39) V55L probably benign Het
Bpifa1 T A 2: 153,988,052 (GRCm39) H198Q possibly damaging Het
Btbd7 A G 12: 102,777,430 (GRCm39) Y466H probably damaging Het
Cdc45 A C 16: 18,605,521 (GRCm39) S480A probably benign Het
Cenpe T C 3: 134,935,839 (GRCm39) Y425H possibly damaging Het
Cep76 A C 18: 67,767,977 (GRCm39) M185R probably damaging Het
Chd5 G T 4: 152,456,122 (GRCm39) M930I probably damaging Het
Clstn2 G T 9: 97,343,395 (GRCm39) T684K probably benign Het
Col4a2 A G 8: 11,491,943 (GRCm39) N1270S possibly damaging Het
Crxos A G 7: 15,636,850 (GRCm39) H141R probably benign Het
Dcc A G 18: 71,553,433 (GRCm39) I741T possibly damaging Het
Ddx20 A T 3: 105,587,685 (GRCm39) C430* probably null Het
Dgki G A 6: 37,273,615 (GRCm39) T12M probably benign Het
Dock6 T C 9: 21,721,153 (GRCm39) N1676S possibly damaging Het
Exosc6 G A 8: 111,783,028 (GRCm39) R9H probably damaging Het
Fstl5 A G 3: 76,569,114 (GRCm39) Q589R probably damaging Het
Gm4846 T A 1: 166,324,959 (GRCm39) Y44F probably benign Het
Gpr15lg A G 14: 36,829,352 (GRCm39) S44P probably damaging Het
Gtf3c2 A C 5: 31,326,401 (GRCm39) I370R probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspg2 A G 4: 137,287,726 (GRCm39) M3696V possibly damaging Het
Itga1 A T 13: 115,166,695 (GRCm39) C167* probably null Het
Khdc4 T C 3: 88,593,853 (GRCm39) S81P probably benign Het
Kpna2 A G 11: 106,880,158 (GRCm39) S497P probably damaging Het
Krt77 T A 15: 101,774,064 (GRCm39) T197S probably damaging Het
Krtap6-5 T C 16: 88,844,655 (GRCm39) Y26C unknown Het
Lhfpl5 A T 17: 28,799,133 (GRCm39) D214V possibly damaging Het
Lrrtm1 A G 6: 77,221,596 (GRCm39) E351G probably damaging Het
Mphosph9 A G 5: 124,403,427 (GRCm39) V867A probably benign Het
Mtcl1 T A 17: 66,650,879 (GRCm39) M1529L probably benign Het
Mthfr A T 4: 148,132,626 (GRCm39) Q268L probably damaging Het
Nbea AC A 3: 55,998,393 (GRCm39) probably null Het
Or1e33 A T 11: 73,738,108 (GRCm39) V281E probably damaging Het
Or4p8 T C 2: 88,727,255 (GRCm39) S229G probably benign Het
Or5an1b A T 19: 12,299,336 (GRCm39) M285K probably damaging Het
Or5m11 T A 2: 85,782,185 (GRCm39) Y259* probably null Het
P2rx5 A T 11: 73,062,655 (GRCm39) T455S probably damaging Het
Palld A T 8: 61,969,591 (GRCm39) F1244L unknown Het
Pbld1 A G 10: 62,907,829 (GRCm39) T125A Het
Pde3b G A 7: 114,014,697 (GRCm39) probably benign Het
Pfkm T C 15: 98,019,188 (GRCm39) S180P probably damaging Het
Pla2g4d T A 2: 120,100,453 (GRCm39) R626S possibly damaging Het
Postn A G 3: 54,282,515 (GRCm39) E492G possibly damaging Het
Prph2 A G 17: 47,230,818 (GRCm39) D237G probably damaging Het
Psmd4 T C 3: 94,942,604 (GRCm39) H105R probably damaging Het
Pygl T C 12: 70,242,401 (GRCm39) N685S probably damaging Het
Rp1 A G 1: 4,315,266 (GRCm39) F502S unknown Het
Sik1 T C 17: 32,066,167 (GRCm39) I607V probably benign Het
Slc26a3 T A 12: 31,513,470 (GRCm39) I464N possibly damaging Het
Slc38a9 A G 13: 112,825,910 (GRCm39) N116S probably damaging Het
Sorcs2 C A 5: 36,181,910 (GRCm39) probably null Het
Spink5 T C 18: 44,119,367 (GRCm39) L226P probably damaging Het
Tab1 G A 15: 80,034,754 (GRCm39) V180I probably benign Het
Tacc2 C T 7: 130,226,209 (GRCm39) R965C probably benign Het
Tacc2 T G 7: 130,226,058 (GRCm39) S914R probably damaging Het
Tlr9 A G 9: 106,101,972 (GRCm39) D421G probably damaging Het
Tmem181a T C 17: 6,307,265 (GRCm39) L16P probably damaging Het
Trim58 A T 11: 58,542,075 (GRCm39) H345L probably damaging Het
Ttc13 G A 8: 125,400,290 (GRCm39) R688C probably benign Het
Ube2o C A 11: 116,433,664 (GRCm39) V685L probably damaging Het
Uso1 A G 5: 92,335,173 (GRCm39) H511R probably benign Het
Vmn2r5 A T 3: 64,411,721 (GRCm39) Y282* probably null Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80,492,566 (GRCm39) missense probably benign
IGL01087:Myo1d APN 11 80,573,261 (GRCm39) missense probably damaging 1.00
IGL01326:Myo1d APN 11 80,575,147 (GRCm39) splice site probably benign
IGL01431:Myo1d APN 11 80,565,665 (GRCm39) missense probably damaging 1.00
IGL01595:Myo1d APN 11 80,566,936 (GRCm39) missense probably benign 0.00
IGL01811:Myo1d APN 11 80,583,823 (GRCm39) missense probably damaging 0.96
IGL02301:Myo1d APN 11 80,567,679 (GRCm39) missense probably benign 0.23
IGL02388:Myo1d APN 11 80,528,823 (GRCm39) nonsense probably null
IGL02485:Myo1d APN 11 80,557,407 (GRCm39) missense probably damaging 1.00
IGL03017:Myo1d APN 11 80,492,452 (GRCm39) missense probably benign 0.26
horton UTSW 11 80,565,534 (GRCm39) missense probably damaging 1.00
multifaceted UTSW 11 80,583,898 (GRCm39) missense probably damaging 1.00
whisper UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
whisper2 UTSW 11 80,557,404 (GRCm39) missense probably damaging 1.00
whisper3 UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R0069:Myo1d UTSW 11 80,528,779 (GRCm39) missense probably damaging 1.00
R0069:Myo1d UTSW 11 80,528,779 (GRCm39) missense probably damaging 1.00
R0081:Myo1d UTSW 11 80,448,349 (GRCm39) missense probably benign 0.00
R0096:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0096:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0244:Myo1d UTSW 11 80,565,534 (GRCm39) missense probably damaging 1.00
R0711:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0746:Myo1d UTSW 11 80,477,705 (GRCm39) missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80,575,221 (GRCm39) missense probably damaging 1.00
R1514:Myo1d UTSW 11 80,576,734 (GRCm39) missense probably damaging 0.97
R1676:Myo1d UTSW 11 80,575,247 (GRCm39) missense probably damaging 1.00
R1862:Myo1d UTSW 11 80,553,874 (GRCm39) missense probably damaging 1.00
R2497:Myo1d UTSW 11 80,565,647 (GRCm39) missense probably damaging 1.00
R2512:Myo1d UTSW 11 80,670,543 (GRCm39) missense probably benign 0.00
R3425:Myo1d UTSW 11 80,492,464 (GRCm39) missense probably benign
R3429:Myo1d UTSW 11 80,573,236 (GRCm39) missense probably damaging 1.00
R3917:Myo1d UTSW 11 80,557,404 (GRCm39) missense probably damaging 1.00
R3928:Myo1d UTSW 11 80,375,087 (GRCm39) missense probably benign 0.09
R4706:Myo1d UTSW 11 80,557,467 (GRCm39) missense probably damaging 0.96
R4723:Myo1d UTSW 11 80,670,667 (GRCm39) utr 5 prime probably benign
R4924:Myo1d UTSW 11 80,565,504 (GRCm39) missense probably damaging 1.00
R5042:Myo1d UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R5320:Myo1d UTSW 11 80,575,149 (GRCm39) critical splice donor site probably null
R5481:Myo1d UTSW 11 80,553,921 (GRCm39) missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80,670,617 (GRCm39) start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80,583,770 (GRCm39) missense probably benign 0.23
R6282:Myo1d UTSW 11 80,448,338 (GRCm39) missense probably damaging 0.99
R6468:Myo1d UTSW 11 80,448,300 (GRCm39) missense probably benign 0.00
R6668:Myo1d UTSW 11 80,474,701 (GRCm39) intron probably benign
R6954:Myo1d UTSW 11 80,565,783 (GRCm39) missense probably benign 0.21
R7077:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7078:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7080:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7172:Myo1d UTSW 11 80,483,621 (GRCm39) missense probably benign 0.16
R7276:Myo1d UTSW 11 80,583,898 (GRCm39) missense probably damaging 1.00
R7467:Myo1d UTSW 11 80,477,743 (GRCm39) missense probably damaging 1.00
R7650:Myo1d UTSW 11 80,492,510 (GRCm39) missense probably benign
R7678:Myo1d UTSW 11 80,567,719 (GRCm39) missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80,575,203 (GRCm39) missense probably damaging 1.00
R8324:Myo1d UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R8329:Myo1d UTSW 11 80,528,900 (GRCm39) missense probably benign 0.21
R8474:Myo1d UTSW 11 80,561,745 (GRCm39) missense possibly damaging 0.93
R8799:Myo1d UTSW 11 80,575,205 (GRCm39) missense probably damaging 1.00
R8810:Myo1d UTSW 11 80,567,758 (GRCm39) missense probably benign 0.30
R8810:Myo1d UTSW 11 80,565,758 (GRCm39) missense probably damaging 1.00
R8823:Myo1d UTSW 11 80,492,571 (GRCm39) missense possibly damaging 0.91
R9494:Myo1d UTSW 11 80,375,093 (GRCm39) missense probably benign 0.02
R9625:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
R9626:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
R9628:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
Z1088:Myo1d UTSW 11 80,565,724 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGCTCAAAGCTACAGGAGAC -3'
(R):5'- GGGAATAGGTGATGTGCATTCTAATC -3'

Sequencing Primer
(F):5'- CTCAAAGCTACAGGAGACAGAAAATG -3'
(R):5'- GGTGATGTGCATTCTAATCATTCTAC -3'
Posted On 2022-02-07