Incidental Mutation 'R9231:Flg2'
ID 700224
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R9231 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 93197278-93221391 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 93202201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 512 (S512L)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: S512L
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: S512L

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,211,092 Q1073R probably benign Het
AI314180 A G 4: 58,875,533 Y144H probably damaging Het
Akirin2 A G 4: 34,551,072 T10A possibly damaging Het
Ankrd13a T A 5: 114,804,234 I526N probably damaging Het
Ankrd28 A G 14: 31,707,277 V876A possibly damaging Het
Aqp8 T A 7: 123,462,590 M11K probably benign Het
Catsper3 T C 13: 55,798,892 I134T possibly damaging Het
Cdk9 G T 2: 32,707,994 T350N probably benign Het
Ckmt2 G T 13: 91,863,192 H100N probably damaging Het
Cnnm4 A T 1: 36,472,177 D162V probably benign Het
Cnppd1 T C 1: 75,139,617 H108R possibly damaging Het
Col17a1 G A 19: 47,679,422 R139* probably null Het
Cyp2c65 C T 19: 39,072,217 P174S possibly damaging Het
Dync2li1 A G 17: 84,628,391 S39G probably null Het
Eif2ak4 A G 2: 118,441,181 D882G probably benign Het
Emp1 C T 6: 135,377,278 T23I probably damaging Het
Epha8 T A 4: 136,945,915 D186V probably damaging Het
Fam169a T G 13: 97,118,459 D394E probably benign Het
Fam20b T C 1: 156,681,514 D376G probably benign Het
Fam46a T G 9: 85,326,335 D145A possibly damaging Het
Fgfbp3 C T 19: 36,918,793 A142T possibly damaging Het
Fras1 T A 5: 96,545,045 C188S probably damaging Het
Galr2 T C 11: 116,283,509 C322R probably benign Het
Gbe1 T A 16: 70,488,101 M437K possibly damaging Het
Glt1d1 T A 5: 127,677,277 L181Q probably damaging Het
Gm14025 A T 2: 129,037,420 I862N unknown Het
Gpr180 G A 14: 118,158,043 V296I probably damaging Het
Gucy1a1 C T 3: 82,106,001 E445K probably damaging Het
H2-T24 T C 17: 36,020,471 D14G possibly damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Ing5 T G 1: 93,811,783 D37E probably benign Het
Kcnt1 A G 2: 25,911,062 T1051A probably benign Het
Kif1b A T 4: 149,191,195 S1420T possibly damaging Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Kmt2a A G 9: 44,848,615 F646L probably damaging Het
Lrp1 T C 10: 127,546,399 D3731G probably benign Het
Mif T A 10: 75,859,536 I97F probably damaging Het
Mpp4 A T 1: 59,124,674 V507D probably damaging Het
Mrpl1 C A 5: 96,213,860 N35K probably benign Het
Naf1 CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,494 probably benign Het
Nat8f6 A G 6: 85,808,648 V173A probably damaging Het
Ninl C T 2: 150,950,209 R798Q probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Olfr366 A T 2: 37,219,977 M163L possibly damaging Het
Olfr517 T C 7: 108,868,633 I174V possibly damaging Het
Paqr8 A G 1: 20,935,651 H343R probably benign Het
Parp14 A G 16: 35,841,213 V1455A probably damaging Het
Parp3 A T 9: 106,473,692 S334T probably benign Het
Pcbp2 T G 15: 102,486,042 probably null Het
Perm1 A T 4: 156,217,777 E259D probably damaging Het
Plce1 A T 19: 38,716,596 N815I probably benign Het
Plxnb1 A T 9: 109,105,218 D838V possibly damaging Het
Prdm12 A G 2: 31,640,253 D52G probably benign Het
Rac2 T C 15: 78,566,023 N39S probably damaging Het
Smchd1 A T 17: 71,365,089 C1657S probably benign Het
Sugct T A 13: 17,452,486 T261S probably damaging Het
Tbc1d10a T C 11: 4,214,885 L446P probably damaging Het
Tcp1 T A 17: 12,917,874 D47E probably damaging Het
Tenm3 T A 8: 48,236,196 T2119S probably damaging Het
Tmem132b T C 5: 125,783,467 M592T probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Washc2 C A 6: 116,258,938 D1123E probably benign Het
Wee2 A G 6: 40,463,155 I412M probably damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
R8670:Flg2 UTSW 3 93201484 missense probably damaging 0.97
R8755:Flg2 UTSW 3 93200813 missense probably damaging 1.00
R9039:Flg2 UTSW 3 93203592 missense unknown
R9116:Flg2 UTSW 3 93202284 missense unknown
R9214:Flg2 UTSW 3 93203577 missense unknown
R9553:Flg2 UTSW 3 93214594 missense unknown
R9607:Flg2 UTSW 3 93201412 missense probably damaging 0.98
R9735:Flg2 UTSW 3 93220362 missense unknown
R9752:Flg2 UTSW 3 93201160 missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGAATCAGGTCAGTCTTGCTGTG -3'
(R):5'- TGCTGAGAGCCAGAACCATG -3'

Sequencing Primer
(F):5'- TGGCCAACATGGTACTGCATC -3'
(R):5'- TGCCCAGAACTAGATGACTGACTG -3'
Posted On 2022-02-07