Incidental Mutation 'R8670:Flg2'
ID661085
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R8670 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93201484 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 273 (Q273L)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098884
AA Change: Q273L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: Q273L

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik A G 13: 24,746,257 E162G probably benign Het
Abca8a A T 11: 110,075,598 L403Q probably damaging Het
Actl11 T C 9: 107,928,760 F94S possibly damaging Het
Adam34 C T 8: 43,652,089 C173Y possibly damaging Het
Ankrd24 C T 10: 81,629,692 probably benign Het
Atp12a A T 14: 56,380,089 D612V probably damaging Het
Cacna2d1 T C 5: 15,935,015 M1T probably null Het
Ccdc178 T C 18: 22,097,662 E384G possibly damaging Het
Cd82 T A 2: 93,420,560 T212S probably benign Het
Cdk17 T A 10: 93,226,096 L263* probably null Het
Cfap57 T G 4: 118,614,925 I86L possibly damaging Het
Chd5 T C 4: 152,385,496 M1842T possibly damaging Het
Clcn7 T C 17: 25,159,614 F691S probably damaging Het
Cpvl A T 6: 53,974,795 M1K probably null Het
Cym T C 3: 107,211,496 probably null Het
Diaph3 T C 14: 86,656,399 E1147G probably benign Het
Dirc2 G T 16: 35,735,635 Q152K possibly damaging Het
Eif4g3 T G 4: 138,158,512 probably null Het
Esp3 A G 17: 40,632,149 D11G probably benign Het
Exoc1 A G 5: 76,569,658 Y865C probably damaging Het
Fuca1 G A 4: 135,922,971 V118I possibly damaging Het
Gga3 T C 11: 115,587,716 N417D probably benign Het
Gm5724 G A 6: 141,765,742 T81I possibly damaging Het
Gm9573 T A 17: 35,621,648 T549S unknown Het
Il1rl1 A T 1: 40,441,399 I63F probably damaging Het
Kif26b A G 1: 178,913,784 Y785C probably damaging Het
Kif5b A C 18: 6,214,631 S599A probably benign Het
Klhl22 T A 16: 17,776,463 I152N probably damaging Het
Mex3c GC G 18: 73,589,705 probably null Het
Olfr229 A G 9: 39,910,423 I207V probably benign Het
Olfr668 A T 7: 104,925,212 M184K probably damaging Het
Orc3 A T 4: 34,572,529 I633N probably damaging Het
Pclo G A 5: 14,682,047 R3521H unknown Het
Plec A G 15: 76,177,526 L2737P probably damaging Het
Prom1 T A 5: 44,001,844 I813F probably benign Het
Prpf40b T A 15: 99,309,740 M517K probably damaging Het
Rab8a TA TAA 8: 72,171,286 probably null Het
Rnf213 T C 11: 119,458,737 L3808P Het
Scnn1b A G 7: 121,899,249 K4R probably benign Het
Siglec1 A G 2: 131,081,467 S453P probably damaging Het
Sim1 A G 10: 50,908,753 K165E probably damaging Het
Smarce1 T C 11: 99,210,272 T345A possibly damaging Het
Spty2d1 T C 7: 46,997,771 N470S probably benign Het
Stab2 T A 10: 86,940,723 D763V probably damaging Het
Tbl1xr1 A T 3: 22,191,000 E171D probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tex15 T A 8: 33,574,718 I1392K probably benign Het
Thada T C 17: 84,432,346 E827G probably benign Het
Ttc3 A G 16: 94,390,208 Y185C probably damaging Het
Vmn2r18 C A 5: 151,562,389 D547Y probably damaging Het
Wdpcp T C 11: 21,695,196 V208A probably benign Het
Zfp322a T A 13: 23,357,104 Q156L possibly damaging Het
Zfp947 T C 17: 22,145,706 D329G probably benign Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
R8755:Flg2 UTSW 3 93200813 missense probably damaging 1.00
R9039:Flg2 UTSW 3 93203592 missense unknown
R9116:Flg2 UTSW 3 93202284 missense unknown
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGACAAGTCATATGATAGCCCC -3'
(R):5'- TTGACAACATCTAGAGGACTGACC -3'

Sequencing Primer
(F):5'- TGATAGCCCCTCTAGAGAATCTGAG -3'
(R):5'- GGACTGACCTTCTGAGACAC -3'
Posted On2021-03-08