Incidental Mutation 'R9243:Exoc2'
ID 701111
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock # R9243 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 30813919-30974093 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30925795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 197 (K197E)
Ref Sequence ENSEMBL: ENSMUSP00000021785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
PDB Structure RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000021785
AA Change: K197E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: K197E

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102946
AA Change: K197E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: K197E

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 53,141,252 S1816R probably benign Het
Appl1 A T 14: 26,927,753 F605L possibly damaging Het
Cacna1g T A 11: 94,457,067 I732F possibly damaging Het
Capg T A 6: 72,561,087 S319T probably benign Het
Cdh17 T A 4: 11,771,333 F38L probably benign Het
Cep295 T A 9: 15,332,309 N1617I probably benign Het
Cep57 C T 9: 13,826,908 probably benign Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
Dock7 A G 4: 98,969,634 V1481A unknown Het
Fancg C T 4: 43,006,565 V330I possibly damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gad2 A G 2: 22,635,041 E279G possibly damaging Het
Gria1 A G 11: 57,238,062 Y454C probably benign Het
Grik3 C T 4: 125,707,897 R856C probably benign Het
Hdac4 C A 1: 91,972,789 R622I probably damaging Het
Hdac4 T C 1: 91,972,790 R622G probably benign Het
Idh1 A G 1: 65,168,497 probably null Het
Igf1r A G 7: 68,212,027 S1112G probably benign Het
Impg2 A T 16: 56,231,460 S242C probably damaging Het
Itgb1 T A 8: 128,707,106 S34T probably benign Het
Kcnh8 A G 17: 52,898,514 I546V probably damaging Het
Klrd1 T G 6: 129,591,832 M1R probably null Het
Krtap16-1 A T 11: 99,985,818 C253* probably null Het
Mapk7 A G 11: 61,493,709 I57T possibly damaging Het
Msrb2 A G 2: 19,383,262 N74D probably benign Het
Myd88 A T 9: 119,339,707 S85T probably benign Het
Myo1c G T 11: 75,650,611 probably benign Het
Nap1l3 C A X: 122,396,814 S69I unknown Het
Nnt T A 13: 119,357,524 N674Y unknown Het
Nrcam A G 12: 44,573,824 Y878C probably damaging Het
Obscn T C 11: 59,132,566 T662A probably benign Het
Olfr1090 A G 2: 86,753,938 S267P possibly damaging Het
Olfr115 T C 17: 37,610,517 Q78R probably benign Het
Olfr615 A G 7: 103,560,575 S33G probably benign Het
Olfr724 A G 14: 49,960,424 V216A probably benign Het
Pappa2 C A 1: 158,936,193 V583L probably damaging Het
Parp1 T G 1: 180,588,115 S500A probably benign Het
Pcdhb17 A G 18: 37,486,936 D593G probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Prrc1 C G 18: 57,363,199 S74W possibly damaging Het
Rag2 G A 2: 101,630,074 G243D probably damaging Het
Sgpp1 T C 12: 75,735,187 E126G probably damaging Het
Skiv2l G A 17: 34,845,222 T496M probably benign Het
Slc17a1 C A 13: 23,880,449 F329L probably benign Het
Slc52a3 G A 2: 152,004,592 V158I probably benign Het
Slf1 T A 13: 77,125,456 T75S possibly damaging Het
Smok2b G A 17: 13,234,750 probably null Het
Tmem125 A T 4: 118,541,892 V114E probably damaging Het
Ube2f A T 1: 91,254,258 probably benign Het
Zdhhc19 T A 16: 32,497,174 F30I probably damaging Het
Zfp462 C A 4: 55,009,595 Y520* probably null Het
Zzz3 A G 3: 152,428,283 D326G probably damaging Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1367:Exoc2 UTSW 13 30882273 nonsense probably null
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2227:Exoc2 UTSW 13 30864884 missense probably benign
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 30820623 missense probably benign 0.03
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6548:Exoc2 UTSW 13 30826064 missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7613:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7767:Exoc2 UTSW 13 30876769 missense probably benign 0.01
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7795:Exoc2 UTSW 13 30876773 nonsense probably null
R7993:Exoc2 UTSW 13 30906730 critical splice donor site probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8716:Exoc2 UTSW 13 30911244 missense probably damaging 1.00
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R8922:Exoc2 UTSW 13 30871855 missense probably benign 0.05
R9237:Exoc2 UTSW 13 30864875 missense probably benign
R9365:Exoc2 UTSW 13 30856714 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCAGCCTAGTCTGCAAC -3'
(R):5'- GGACCTGACATGCTTGGAATTATC -3'

Sequencing Primer
(F):5'- GTCTGCAACAAATATTTATGGTACGC -3'
(R):5'- GGAGTGTCAGACAGTTGAT -3'
Posted On 2022-03-25