Mutagenetix > Incidental Mutation

Incidental Mutation 'R9243:Exoc2'

701111

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R9243 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30925795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 197 (K197E)

Ref Sequence

ENSEMBL: ENSMUSP00000021785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

PDB Structure

RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000021785
AA Change: K197E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: K197E

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102946
AA Change: K197E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: K197E

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap6	T	A	12: 53,141,252	S1816R	probably benign	Het
Appl1	A	T	14: 26,927,753	F605L	possibly damaging	Het
Cacna1g	T	A	11: 94,457,067	I732F	possibly damaging	Het
Capg	T	A	6: 72,561,087	S319T	probably benign	Het
Cdh17	T	A	4: 11,771,333	F38L	probably benign	Het
Cep295	T	A	9: 15,332,309	N1617I	probably benign	Het
Cep57	C	T	9: 13,826,908		probably benign	Het
Cfap46	A	T	7: 139,615,349		probably benign	Het
Csnk1g2	C	A	10: 80,639,814	A405E	probably damaging	Het
Dock7	A	G	4: 98,969,634	V1481A	unknown	Het
Fancg	C	T	4: 43,006,565	V330I	possibly damaging	Het
Fktn	G	A	4: 53,734,854	G125D	probably benign	Het
Gad2	A	G	2: 22,635,041	E279G	possibly damaging	Het
Gria1	A	G	11: 57,238,062	Y454C	probably benign	Het
Grik3	C	T	4: 125,707,897	R856C	probably benign	Het
Hdac4	C	A	1: 91,972,789	R622I	probably damaging	Het
Hdac4	T	C	1: 91,972,790	R622G	probably benign	Het
Htt	T	C	5: 34,898,932		probably benign	Het
Idh1	A	G	1: 65,168,497		probably null	Het
Igf1r	A	G	7: 68,212,027	S1112G	probably benign	Het
Impg2	A	T	16: 56,231,460	S242C	probably damaging	Het
Itgb1	T	A	8: 128,707,106	S34T	probably benign	Het
Kcnh8	A	G	17: 52,898,514	I546V	probably damaging	Het
Klrd1	T	G	6: 129,591,832	M1R	probably null	Het
Krtap16-1	A	T	11: 99,985,818	C253*	probably null	Het
Mapk7	A	G	11: 61,493,709	I57T	possibly damaging	Het
Msrb2	A	G	2: 19,383,262	N74D	probably benign	Het
Myd88	A	T	9: 119,339,707	S85T	probably benign	Het
Myo1c	G	T	11: 75,650,611		probably benign	Het
Nnt	T	A	13: 119,357,524	N674Y	unknown	Het
Nrcam	A	G	12: 44,573,824	Y878C	probably damaging	Het
Obscn	T	C	11: 59,132,566	T662A	probably benign	Het
Olfr1090	A	G	2: 86,753,938	S267P	possibly damaging	Het
Olfr115	T	C	17: 37,610,517	Q78R	probably benign	Het
Olfr615	A	G	7: 103,560,575	S33G	probably benign	Het
Olfr724	A	G	14: 49,960,424	V216A	probably benign	Het
Pappa2	C	A	1: 158,936,193	V583L	probably damaging	Het
Parp1	T	G	1: 180,588,115	S500A	probably benign	Het
Pcdhb17	A	G	18: 37,486,936	D593G	probably damaging	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 172,128,583		probably null	Het
Prrc1	C	G	18: 57,363,199	S74W	possibly damaging	Het
Rag2	G	A	2: 101,630,074	G243D	probably damaging	Het
Sgpp1	T	C	12: 75,735,187	E126G	probably damaging	Het
Skiv2l	G	A	17: 34,845,222	T496M	probably benign	Het
Slc17a1	C	A	13: 23,880,449	F329L	probably benign	Het
Slc52a3	G	A	2: 152,004,592	V158I	probably benign	Het
Slf1	T	A	13: 77,125,456	T75S	possibly damaging	Het
Smok2b	G	A	17: 13,234,750		probably null	Het
Tmem125	A	T	4: 118,541,892	V114E	probably damaging	Het
Ube2f	A	T	1: 91,254,258		probably benign	Het
Zdhhc19	T	A	16: 32,497,174	F30I	probably damaging	Het
Zfp236	T	C	18: 82,643,925		probably benign	Het
Zfp462	C	A	4: 55,009,595	Y520*	probably null	Het
Zzz3	A	G	3: 152,428,283	D326G	probably damaging	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00
R9731:Exoc2	UTSW	13	30877250	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TTCCAGCCTAGTCTGCAAC -3'
(R):5'- GGACCTGACATGCTTGGAATTATC -3'

Sequencing Primer
(F):5'- GTCTGCAACAAATATTTATGGTACGC -3'
(R):5'- GGAGTGTCAGACAGTTGAT -3'

Posted On

2022-03-25