Incidental Mutation 'R9243:Akap6'
ID 701108
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene Name A kinase (PRKA) anchor protein 6
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.729) question?
Stock # R9243 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 52699383-53155599 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53141252 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1816 (S1816R)
Ref Sequence ENSEMBL: ENSMUSP00000093406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
AlphaFold E9Q9K8
Predicted Effect probably benign
Transcript: ENSMUST00000095737
AA Change: S1816R

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: S1816R

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219786
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 A T 14: 26,927,753 F605L possibly damaging Het
Cacna1g T A 11: 94,457,067 I732F possibly damaging Het
Capg T A 6: 72,561,087 S319T probably benign Het
Cdh17 T A 4: 11,771,333 F38L probably benign Het
Cep295 T A 9: 15,332,309 N1617I probably benign Het
Cep57 C T 9: 13,826,908 probably benign Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
Dock7 A G 4: 98,969,634 V1481A unknown Het
Exoc2 T C 13: 30,925,795 K197E probably benign Het
Fancg C T 4: 43,006,565 V330I possibly damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gad2 A G 2: 22,635,041 E279G possibly damaging Het
Gria1 A G 11: 57,238,062 Y454C probably benign Het
Grik3 C T 4: 125,707,897 R856C probably benign Het
Hdac4 C A 1: 91,972,789 R622I probably damaging Het
Hdac4 T C 1: 91,972,790 R622G probably benign Het
Idh1 A G 1: 65,168,497 probably null Het
Igf1r A G 7: 68,212,027 S1112G probably benign Het
Impg2 A T 16: 56,231,460 S242C probably damaging Het
Itgb1 T A 8: 128,707,106 S34T probably benign Het
Kcnh8 A G 17: 52,898,514 I546V probably damaging Het
Klrd1 T G 6: 129,591,832 M1R probably null Het
Krtap16-1 A T 11: 99,985,818 C253* probably null Het
Mapk7 A G 11: 61,493,709 I57T possibly damaging Het
Msrb2 A G 2: 19,383,262 N74D probably benign Het
Myd88 A T 9: 119,339,707 S85T probably benign Het
Myo1c G T 11: 75,650,611 probably benign Het
Nap1l3 C A X: 122,396,814 S69I unknown Het
Nnt T A 13: 119,357,524 N674Y unknown Het
Nrcam A G 12: 44,573,824 Y878C probably damaging Het
Obscn T C 11: 59,132,566 T662A probably benign Het
Olfr1090 A G 2: 86,753,938 S267P possibly damaging Het
Olfr115 T C 17: 37,610,517 Q78R probably benign Het
Olfr615 A G 7: 103,560,575 S33G probably benign Het
Olfr724 A G 14: 49,960,424 V216A probably benign Het
Pappa2 C A 1: 158,936,193 V583L probably damaging Het
Parp1 T G 1: 180,588,115 S500A probably benign Het
Pcdhb17 A G 18: 37,486,936 D593G probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Prrc1 C G 18: 57,363,199 S74W possibly damaging Het
Rag2 G A 2: 101,630,074 G243D probably damaging Het
Sgpp1 T C 12: 75,735,187 E126G probably damaging Het
Skiv2l G A 17: 34,845,222 T496M probably benign Het
Slc17a1 C A 13: 23,880,449 F329L probably benign Het
Slc52a3 G A 2: 152,004,592 V158I probably benign Het
Slf1 T A 13: 77,125,456 T75S possibly damaging Het
Smok2b G A 17: 13,234,750 probably null Het
Tmem125 A T 4: 118,541,892 V114E probably damaging Het
Ube2f A T 1: 91,254,258 probably benign Het
Zdhhc19 T A 16: 32,497,174 F30I probably damaging Het
Zfp462 C A 4: 55,009,595 Y520* probably null Het
Zzz3 A G 3: 152,428,283 D326G probably damaging Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53140980 missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52887102 missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52937217 missense probably damaging 0.96
IGL01458:Akap6 APN 12 52886818 nonsense probably null
IGL01589:Akap6 APN 12 53139664 missense probably damaging 1.00
IGL01592:Akap6 APN 12 53142142 missense probably damaging 1.00
IGL01738:Akap6 APN 12 52886817 missense probably damaging 0.99
IGL01867:Akap6 APN 12 52888008 missense probably damaging 1.00
IGL02025:Akap6 APN 12 53140335 missense probably benign
IGL02041:Akap6 APN 12 53140653 missense probably damaging 1.00
IGL02058:Akap6 APN 12 53140555 missense probably damaging 1.00
IGL02194:Akap6 APN 12 52886823 missense probably benign 0.00
IGL02226:Akap6 APN 12 53010467 splice site probably benign
IGL02323:Akap6 APN 12 53140429 missense probably benign 0.00
IGL02449:Akap6 APN 12 53140188 missense probably damaging 1.00
IGL02475:Akap6 APN 12 53139494 missense probably benign 0.03
IGL02546:Akap6 APN 12 52880738 missense probably damaging 1.00
IGL02547:Akap6 APN 12 53140696 missense probably damaging 1.00
IGL02588:Akap6 APN 12 52886499 nonsense probably null
IGL02608:Akap6 APN 12 53010606 missense probably benign 0.39
IGL02884:Akap6 APN 12 52886622 missense probably benign 0.00
IGL02945:Akap6 APN 12 52880837 missense probably damaging 1.00
IGL03029:Akap6 APN 12 52886412 missense probably damaging 1.00
IGL03129:Akap6 APN 12 53140306 missense probably damaging 1.00
R0133:Akap6 UTSW 12 53139471 nonsense probably null
R0166:Akap6 UTSW 12 53140924 missense probably benign 0.04
R0189:Akap6 UTSW 12 53141254 missense probably benign 0.41
R0532:Akap6 UTSW 12 52887983 missense probably benign 0.00
R0632:Akap6 UTSW 12 52937148 missense probably damaging 1.00
R0666:Akap6 UTSW 12 52911808 missense probably damaging 1.00
R0723:Akap6 UTSW 12 53141902 missense probably damaging 1.00
R0763:Akap6 UTSW 12 53142214 missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52886622 missense probably benign 0.00
R0879:Akap6 UTSW 12 52880799 missense probably damaging 1.00
R0880:Akap6 UTSW 12 53139508 missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53069222 missense probably damaging 0.97
R1055:Akap6 UTSW 12 52880672 nonsense probably null
R1199:Akap6 UTSW 12 52796190 missense probably damaging 1.00
R1295:Akap6 UTSW 12 52887029 missense probably damaging 1.00
R1389:Akap6 UTSW 12 53139520 missense probably benign 0.15
R1471:Akap6 UTSW 12 53141496 missense probably benign 0.05
R1483:Akap6 UTSW 12 52796087 missense probably damaging 1.00
R1512:Akap6 UTSW 12 52937154 missense probably damaging 1.00
R1648:Akap6 UTSW 12 53142006 nonsense probably null
R1791:Akap6 UTSW 12 53069125 missense probably damaging 1.00
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53141852 missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53104612 missense probably benign 0.13
R1970:Akap6 UTSW 12 52938475 missense probably damaging 0.96
R1987:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53141404 missense probably benign 0.03
R2567:Akap6 UTSW 12 52938373 missense probably damaging 1.00
R2568:Akap6 UTSW 12 52887278 missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53140143 missense probably benign
R3051:Akap6 UTSW 12 52887033 missense probably damaging 1.00
R3195:Akap6 UTSW 12 53072457 nonsense probably null
R3196:Akap6 UTSW 12 53072457 nonsense probably null
R3426:Akap6 UTSW 12 52888034 missense probably damaging 1.00
R3783:Akap6 UTSW 12 52880769 missense probably damaging 1.00
R3934:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R3970:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R4042:Akap6 UTSW 12 53139379 critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53139462 missense probably damaging 1.00
R4152:Akap6 UTSW 12 53140407 missense probably benign 0.45
R4231:Akap6 UTSW 12 53141038 missense probably damaging 1.00
R4232:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4233:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4234:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4235:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4236:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4475:Akap6 UTSW 12 53141643 missense probably benign 0.00
R4513:Akap6 UTSW 12 52796004 missense probably benign 0.03
R4686:Akap6 UTSW 12 52887623 frame shift probably null
R4724:Akap6 UTSW 12 52795885 missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52887623 frame shift probably null
R4852:Akap6 UTSW 12 53104675 missense probably damaging 1.00
R5024:Akap6 UTSW 12 53142562 missense probably benign 0.01
R5116:Akap6 UTSW 12 53141515 missense probably benign 0.01
R5164:Akap6 UTSW 12 53142466 missense probably benign
R5225:Akap6 UTSW 12 52886546 missense probably damaging 1.00
R5269:Akap6 UTSW 12 53139843 missense probably damaging 0.99
R5352:Akap6 UTSW 12 52796097 missense probably damaging 1.00
R5496:Akap6 UTSW 12 53140653 missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52795964 missense probably damaging 1.00
R5997:Akap6 UTSW 12 52937233 critical splice donor site probably null
R6137:Akap6 UTSW 12 53140354 missense probably damaging 1.00
R6151:Akap6 UTSW 12 53025792 missense probably damaging 1.00
R6169:Akap6 UTSW 12 53142358 missense probably benign
R6307:Akap6 UTSW 12 53141568 missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53142025 missense probably damaging 0.98
R6479:Akap6 UTSW 12 53141169 missense probably damaging 1.00
R6502:Akap6 UTSW 12 53140215 missense probably damaging 1.00
R6760:Akap6 UTSW 12 53139778 missense probably damaging 1.00
R6778:Akap6 UTSW 12 53025816 missense probably damaging 1.00
R6837:Akap6 UTSW 12 53141262 missense probably damaging 1.00
R6896:Akap6 UTSW 12 52887494 missense probably benign 0.06
R6917:Akap6 UTSW 12 53069168 missense probably null 0.97
R6983:Akap6 UTSW 12 52887653 missense probably damaging 1.00
R7142:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7143:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7216:Akap6 UTSW 12 53140457 missense probably benign 0.02
R7297:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7356:Akap6 UTSW 12 52911864 missense probably damaging 1.00
R7378:Akap6 UTSW 12 53142574 missense probably benign 0.00
R7382:Akap6 UTSW 12 53142171 missense probably benign 0.00
R7498:Akap6 UTSW 12 53142705 nonsense probably null
R7542:Akap6 UTSW 12 53069234 missense probably damaging 1.00
R7589:Akap6 UTSW 12 53142063 nonsense probably null
R7676:Akap6 UTSW 12 52886850 missense possibly damaging 0.94
R7814:Akap6 UTSW 12 53140961 missense probably benign 0.28
R7971:Akap6 UTSW 12 53139795 missense probably damaging 1.00
R8039:Akap6 UTSW 12 53141676 missense probably benign 0.00
R8425:Akap6 UTSW 12 52886621 missense probably benign 0.00
R8747:Akap6 UTSW 12 53142216 missense probably benign 0.01
R8885:Akap6 UTSW 12 53141536 missense probably benign
R8956:Akap6 UTSW 12 53140344 missense probably benign 0.00
R8989:Akap6 UTSW 12 52880871 missense probably damaging 1.00
R9014:Akap6 UTSW 12 53139620 missense possibly damaging 0.60
R9031:Akap6 UTSW 12 53142048 missense probably benign 0.36
R9216:Akap6 UTSW 12 52880885 missense probably benign 0.05
R9220:Akap6 UTSW 12 53140449 missense possibly damaging 0.49
R9286:Akap6 UTSW 12 53072471 missense possibly damaging 0.90
R9347:Akap6 UTSW 12 53069111 missense probably damaging 1.00
R9475:Akap6 UTSW 12 53010552 missense probably damaging 1.00
R9509:Akap6 UTSW 12 53142238 missense probably damaging 0.99
R9523:Akap6 UTSW 12 52795889 missense probably benign 0.02
X0062:Akap6 UTSW 12 53142361 missense probably benign 0.43
Z1176:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CGGAAGAAGAGCTGTGTCTC -3'
(R):5'- ACATTGCCATTTTCCATGTCGG -3'

Sequencing Primer
(F):5'- TCAAAGATGAGGATGACGACTCC -3'
(R):5'- CACATGTGGATCTTTAGTAACGTCG -3'
Posted On 2022-03-25