Incidental Mutation 'R9403:Glg1'
ID 711350
Institutional Source Beutler Lab
Gene Symbol Glg1
Ensembl Gene ENSMUSG00000003316
Gene Name golgi apparatus protein 1
Synonyms Selel, CFR, MG-160, CFR-1, ESL-1, MG160
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 111154421-111259216 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 111187793 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 453 (R453Q)
Ref Sequence ENSEMBL: ENSMUSP00000131355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003404] [ENSMUST00000164283] [ENSMUST00000169020]
AlphaFold Q61543
Predicted Effect possibly damaging
Transcript: ENSMUST00000003404
AA Change: R442Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003404
Gene: ENSMUSG00000003316
AA Change: R442Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 141 197 3.1e-13 PFAM
Pfam:Cys_rich_FGFR 199 263 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 274 331 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 334 398 1.6e-16 PFAM
Pfam:Cys_rich_FGFR 402 458 1.8e-15 PFAM
Pfam:Cys_rich_FGFR 463 522 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 525 589 5.8e-19 PFAM
Pfam:Cys_rich_FGFR 597 653 6e-17 PFAM
Pfam:Cys_rich_FGFR 654 714 2e-14 PFAM
Pfam:Cys_rich_FGFR 717 773 4.7e-14 PFAM
Pfam:Cys_rich_FGFR 784 841 1e-18 PFAM
Pfam:Cys_rich_FGFR 842 897 4.2e-17 PFAM
Pfam:Cys_rich_FGFR 900 964 2.1e-21 PFAM
Pfam:Cys_rich_FGFR 967 1027 3.5e-16 PFAM
Pfam:Cys_rich_FGFR 1029 1086 8e-17 PFAM
transmembrane domain 1131 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164283
SMART Domains Protein: ENSMUSP00000131659
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 210 267 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169020
AA Change: R453Q

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131355
Gene: ENSMUSG00000003316
AA Change: R453Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.9e-15 PFAM
Pfam:Cys_rich_FGFR 210 274 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 285 342 1.4e-16 PFAM
Pfam:Cys_rich_FGFR 345 409 7.2e-16 PFAM
Pfam:Cys_rich_FGFR 413 469 8.4e-16 PFAM
Pfam:Cys_rich_FGFR 474 533 6.4e-17 PFAM
Pfam:Cys_rich_FGFR 536 600 2.7e-16 PFAM
Pfam:Cys_rich_FGFR 608 664 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 665 725 1.2e-13 PFAM
Pfam:Cys_rich_FGFR 728 784 2.6e-11 PFAM
Pfam:Cys_rich_FGFR 795 852 1.4e-18 PFAM
Pfam:Cys_rich_FGFR 853 908 1.1e-15 PFAM
Pfam:Cys_rich_FGFR 911 975 1e-19 PFAM
Pfam:Cys_rich_FGFR 978 1038 1.3e-15 PFAM
Pfam:Cys_rich_FGFR 1040 1097 6e-17 PFAM
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mice show smaller size, narrow rib cages, short and thin bony elements, and reduced chondrocyte proliferation and growth plates. Homozygotes for a gene trap allele show postnatal death, small size, distorted tails and cleft palate. Homozygotes for another gene trap allele die by E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Glg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Glg1 APN 8 111159849 missense probably damaging 1.00
IGL01326:Glg1 APN 8 111182573 missense probably damaging 0.96
IGL01558:Glg1 APN 8 111187730 missense probably benign 0.00
IGL01798:Glg1 APN 8 111192700 missense possibly damaging 0.58
IGL02651:Glg1 APN 8 111160727 missense possibly damaging 0.76
IGL03124:Glg1 APN 8 111200171 missense probably damaging 1.00
IGL03374:Glg1 APN 8 111162780 missense probably damaging 1.00
IGL03404:Glg1 APN 8 111159902 missense probably damaging 1.00
diabolical UTSW 8 111168743 missense probably damaging 1.00
BB007:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
BB017:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
PIT4362001:Glg1 UTSW 8 111258799 missense possibly damaging 0.80
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0255:Glg1 UTSW 8 111159858 missense possibly damaging 0.82
R0432:Glg1 UTSW 8 111182569 missense probably damaging 1.00
R0458:Glg1 UTSW 8 111160606 splice site probably benign
R0635:Glg1 UTSW 8 111163764 splice site probably benign
R0765:Glg1 UTSW 8 111159797 critical splice donor site probably null
R1104:Glg1 UTSW 8 111197603 missense probably benign 0.01
R1495:Glg1 UTSW 8 111197675 missense probably damaging 1.00
R1747:Glg1 UTSW 8 111197673 missense probably damaging 1.00
R1899:Glg1 UTSW 8 111165674 missense probably benign 0.23
R1950:Glg1 UTSW 8 111165639 missense possibly damaging 0.79
R2074:Glg1 UTSW 8 111168671 missense probably damaging 1.00
R2112:Glg1 UTSW 8 111192546 missense probably damaging 1.00
R2275:Glg1 UTSW 8 111168721 nonsense probably null
R2342:Glg1 UTSW 8 111187807 nonsense probably null
R4633:Glg1 UTSW 8 111177644 critical splice donor site probably null
R4716:Glg1 UTSW 8 111160775 nonsense probably null
R4732:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R4733:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R5594:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R5722:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R5951:Glg1 UTSW 8 111165691 missense possibly damaging 0.64
R5958:Glg1 UTSW 8 111259104 missense probably benign 0.01
R6090:Glg1 UTSW 8 111181035 missense probably damaging 1.00
R6476:Glg1 UTSW 8 111200174 missense possibly damaging 0.94
R6480:Glg1 UTSW 8 111197706 missense possibly damaging 0.89
R6819:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R7116:Glg1 UTSW 8 111178957 missense probably benign 0.22
R7293:Glg1 UTSW 8 111168743 missense probably damaging 1.00
R7431:Glg1 UTSW 8 111160754 missense unknown
R7479:Glg1 UTSW 8 111197735 missense possibly damaging 0.91
R7509:Glg1 UTSW 8 111259043 missense probably benign 0.04
R7547:Glg1 UTSW 8 111187761 missense possibly damaging 0.89
R7678:Glg1 UTSW 8 111178865 missense probably benign 0.19
R7930:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
R8182:Glg1 UTSW 8 111171297 missense possibly damaging 0.88
R8383:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R8787:Glg1 UTSW 8 111161482 missense probably damaging 0.99
R8905:Glg1 UTSW 8 111158036 missense probably damaging 0.99
R8954:Glg1 UTSW 8 111187895 missense probably damaging 1.00
R8958:Glg1 UTSW 8 111172484 nonsense probably null
R9023:Glg1 UTSW 8 111177748 missense probably damaging 0.99
R9113:Glg1 UTSW 8 111160820 intron probably benign
R9359:Glg1 UTSW 8 111187793 missense probably benign 0.08
R9553:Glg1 UTSW 8 111200138 missense probably benign 0.04
R9622:Glg1 UTSW 8 111172501 missense probably damaging 1.00
X0027:Glg1 UTSW 8 111169600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTTCCTTTACCTAGCTCCACAG -3'
(R):5'- AGACTCCCATTTCATAACTGTCTG -3'

Sequencing Primer
(F):5'- AGCAATTGAGTGCCCAGTTC -3'
(R):5'- GTCTGACTTACCCCTGACACAG -3'
Posted On 2022-05-16