Incidental Mutation 'R9403:1700123L14Rik'
ID 711338
Institutional Source Beutler Lab
Gene Symbol 1700123L14Rik
Ensembl Gene ENSMUSG00000072878
Gene Name RIKEN cDNA 1700123L14 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 96164497-96166243 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 96165299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 255 (T255P)
Ref Sequence ENSEMBL: ENSMUSP00000087515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075080] [ENSMUST00000090061] [ENSMUST00000122120]
AlphaFold Q3V2K7
Predicted Effect probably benign
Transcript: ENSMUST00000075080
SMART Domains Protein: ENSMUSP00000074589
Gene: ENSMUSG00000059187

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 40 129 3.9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090061
AA Change: T255P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000087515
Gene: ENSMUSG00000072878
AA Change: T255P

DomainStartEndE-ValueType
Pfam:NUP50 2 73 1.8e-15 PFAM
low complexity region 84 94 N/A INTRINSIC
RanBD 315 438 2.69e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122120
SMART Domains Protein: ENSMUSP00000113152
Gene: ENSMUSG00000059187

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 41 129 4e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in 1700123L14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:1700123L14Rik APN 6 96165694 missense possibly damaging 0.48
IGL02347:1700123L14Rik APN 6 96165530 missense probably damaging 1.00
IGL02532:1700123L14Rik APN 6 96164790 missense probably damaging 0.99
PIT4283001:1700123L14Rik UTSW 6 96165715 missense probably benign
R0282:1700123L14Rik UTSW 6 96164816 missense probably benign 0.02
R0946:1700123L14Rik UTSW 6 96165696 missense possibly damaging 0.68
R1275:1700123L14Rik UTSW 6 96165118 missense probably benign 0.03
R1605:1700123L14Rik UTSW 6 96164812 missense probably benign 0.34
R1610:1700123L14Rik UTSW 6 96165289 missense probably damaging 0.98
R1959:1700123L14Rik UTSW 6 96165269 missense possibly damaging 0.73
R1961:1700123L14Rik UTSW 6 96165269 missense possibly damaging 0.73
R2116:1700123L14Rik UTSW 6 96164860 missense probably damaging 0.99
R3708:1700123L14Rik UTSW 6 96165952 missense possibly damaging 0.92
R4157:1700123L14Rik UTSW 6 96165283 missense possibly damaging 0.86
R4285:1700123L14Rik UTSW 6 96165752 missense probably benign 0.07
R4571:1700123L14Rik UTSW 6 96164881 missense probably damaging 1.00
R4884:1700123L14Rik UTSW 6 96164812 missense probably damaging 1.00
R4905:1700123L14Rik UTSW 6 96165930 missense possibly damaging 0.77
R6454:1700123L14Rik UTSW 6 96165628 missense possibly damaging 0.75
R6755:1700123L14Rik UTSW 6 96164972 missense probably benign 0.06
R6790:1700123L14Rik UTSW 6 96165323 missense probably benign
R6792:1700123L14Rik UTSW 6 96165115 missense possibly damaging 0.92
R6931:1700123L14Rik UTSW 6 96165548 missense possibly damaging 0.86
R7081:1700123L14Rik UTSW 6 96165817 missense possibly damaging 0.68
R7194:1700123L14Rik UTSW 6 96164775 missense probably benign 0.04
R7584:1700123L14Rik UTSW 6 96165392 missense probably benign 0.41
R7938:1700123L14Rik UTSW 6 96164885 missense possibly damaging 0.66
R7983:1700123L14Rik UTSW 6 96165907 missense probably damaging 0.96
R8052:1700123L14Rik UTSW 6 96165097 intron probably benign
R8052:1700123L14Rik UTSW 6 96165103 intron probably benign
R8303:1700123L14Rik UTSW 6 96165721 missense probably benign 0.41
R8351:1700123L14Rik UTSW 6 96165674 missense probably benign 0.12
R8785:1700123L14Rik UTSW 6 96164890 missense possibly damaging 0.87
R8827:1700123L14Rik UTSW 6 96165312 missense probably benign 0.00
R9280:1700123L14Rik UTSW 6 96165001 missense probably damaging 1.00
R9470:1700123L14Rik UTSW 6 96165493 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CTACAAGGAGCTTGCATTCATC -3'
(R):5'- TGAGAAATACTTGGCTGCCATC -3'

Sequencing Primer
(F):5'- AAGGAGCTTGCATTCATCACTGTTG -3'
(R):5'- TACTTGGCTGCCATCGAAAAG -3'
Posted On 2022-05-16