Mutagenetix > Incidental Mutation

Incidental Mutation 'R9508:Vps16'

717914

Institutional Source

Beutler Lab

Gene Symbol

Vps16

Ensembl Gene

ENSMUSG00000027411

Gene Name

VSP16 CORVET/HOPS core subunit

Synonyms

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.973) question?

Stock #

R9508 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

130424339-130444269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 130442441 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 704 (I704N)

Ref Sequence

ENSEMBL: ENSMUSP00000028900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028900
AA Change: I704N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: I704N

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	420	1e-166	PFAM
low complexity region	452	462	N/A	INTRINSIC
Pfam:Vps16_C	517	835	5.5e-150	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128994

SMART Domains

Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	212	3.2e-74	PFAM
Pfam:Vps16_N	205	316	1e-45	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	G	A	13: 119,480,948	V536I		Het
4930444G20Rik	A	G	10: 22,066,917	V388A	probably damaging	Het
Adam18	A	G	8: 24,653,762	I187T	possibly damaging	Het
Adam24	A	G	8: 40,679,902	I136M	probably benign	Het
B3galt2	A	T	1: 143,646,542	I139F	possibly damaging	Het
Cacna1i	C	T	15: 80,395,171	P2038S	probably benign	Het
Cbll1	A	T	12: 31,494,686	I26N	probably damaging	Het
Cldn1	A	T	16: 26,360,869	Y149*	probably null	Het
Cnot11	T	C	1: 39,542,494	V372A	probably damaging	Het
Cnot2	A	G	10: 116,493,711	L458P	probably damaging	Het
Cnot4	T	C	6: 35,068,619	E219G		Het
Col8a1	T	G	16: 57,628,584	I188L	unknown	Het
Daam2	T	C	17: 49,458,590	K1095R	probably damaging	Het
Dnah9	T	C	11: 65,834,263	T4355A	probably damaging	Het
Dsg4	A	G	18: 20,471,013	I846V	probably damaging	Het
Ehd4	C	T	2: 120,091,485	G430E	probably damaging	Het
Fanci	T	C	7: 79,433,285	Y670H	possibly damaging	Het
Galnt10	T	A	11: 57,782,214	N465K	possibly damaging	Het
Glipr1l1	A	G	10: 112,076,110	N183S	probably damaging	Het
Gnl1	T	C	17: 35,988,733	Y599H	possibly damaging	Het
Gpr26	T	C	7: 131,984,101	S267P	probably benign	Het
Grk2	A	T	19: 4,291,608	N179K	probably damaging	Het
Igf2bp2	T	A	16: 22,080,095	M255L	probably benign	Het
Ighv2-6	T	C	12: 113,716,810	I70M	probably benign	Het
Igkv4-74	T	A	6: 69,184,958	N76Y	probably damaging	Het
Il11ra1	T	C	4: 41,767,527	V293A	probably damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kank2	A	T	9: 21,775,780	L582Q	probably damaging	Het
Kmt2b	T	C	7: 30,569,834	T2554A	probably damaging	Het
Mecom	T	A	3: 29,956,472	Y619F	probably benign	Het
Mknk1	A	G	4: 115,875,382	N269S	probably benign	Het
Mpp2	T	A	11: 102,060,866	E435D	probably damaging	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Olfr1009	A	G	2: 85,721,821	R139G	possibly damaging	Het
Olfr452	A	G	6: 42,790,994	*318W	probably null	Het
Olfr57	A	T	10: 79,035,099	Q101L	probably damaging	Het
P3h3	A	G	6: 124,853,049		probably null	Het
Paqr5	C	T	9: 61,972,797	V72M	probably benign	Het
Pilrb2	G	A	5: 137,870,999	T113I	probably damaging	Het
Pitpnm3	T	C	11: 72,112,295	E63G	probably damaging	Het
Ppp4r4	G	A	12: 103,576,302	V108M	possibly damaging	Het
Ptprf	G	T	4: 118,269,579	S46*	probably null	Het
Rab2a	T	C	4: 8,582,447	L143P		Het
Rassf7	C	T	7: 141,217,011	R46*	probably null	Het
Sec23a	T	C	12: 58,989,399	D393G	probably benign	Het
Serpinb9f	T	A	13: 33,334,532	F338L	probably benign	Het
Spg7	T	C	8: 123,073,884	V66A	probably damaging	Het
Sult2a4	C	T	7: 13,989,512	R27H	probably benign	Het
Sumo2	A	C	11: 115,523,712	Y95D	possibly damaging	Het
Tbx18	G	A	9: 87,705,873	S397F	probably damaging	Het
Ticam2	G	C	18: 46,560,681	P113R	probably damaging	Het
Timeless	A	G	10: 128,240,227	S63G	probably benign	Het
Tinag	C	T	9: 77,005,699	C276Y	probably damaging	Het
Tmem143	A	T	7: 45,916,206	K364*	probably null	Het
Tmem160	A	G	7: 16,452,915		probably benign	Het
Tmod4	G	C	3: 95,127,402	E154Q	probably benign	Het
Trpv1	G	T	11: 73,254,264	K725N		Het
Ttn	G	T	2: 76,885,634	A7767D	unknown	Het
Tubd1	T	A	11: 86,557,814	Y318N	probably damaging	Het
Ufd1	T	A	16: 18,825,052	M187K	possibly damaging	Het
Unc5c	A	G	3: 141,788,975	N424D	possibly damaging	Het
Usp19	C	T	9: 108,494,409	S329L	probably damaging	Het
Vwf	A	T	6: 125,555,508	I72F		Het
Ypel4	T	C	2: 84,736,960	S46P	probably damaging	Het
Zcchc8	A	C	5: 123,704,521		probably null	Het

Other mutations in Vps16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Vps16	APN	2	130437696	missense	probably benign	0.19
IGL01400:Vps16	APN	2	130438353	missense	possibly damaging	0.73
IGL01542:Vps16	APN	2	130438394	missense	probably damaging	0.97
IGL02011:Vps16	APN	2	130441479	missense	probably benign	0.04
IGL02192:Vps16	APN	2	130440932	missense	probably damaging	0.98
IGL02220:Vps16	APN	2	130441653	missense	possibly damaging	0.85
IGL02587:Vps16	APN	2	130439716	critical splice donor site	probably null
R0427:Vps16	UTSW	2	130438850	missense	probably benign	0.00
R0507:Vps16	UTSW	2	130437712	critical splice donor site	probably null
R1550:Vps16	UTSW	2	130440340	missense	probably benign	0.09
R1789:Vps16	UTSW	2	130443600	missense	probably benign	0.42
R3895:Vps16	UTSW	2	130438676	missense	possibly damaging	0.96
R3981:Vps16	UTSW	2	130442594	missense	possibly damaging	0.77
R4092:Vps16	UTSW	2	130439912	missense	probably damaging	1.00
R4555:Vps16	UTSW	2	130443576	missense	probably damaging	1.00
R4569:Vps16	UTSW	2	130442204	missense	probably benign
R4803:Vps16	UTSW	2	130438110	missense	probably benign	0.27
R4835:Vps16	UTSW	2	130438300	splice site	probably benign
R5022:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5023:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5057:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5158:Vps16	UTSW	2	130441279	missense	probably damaging	1.00
R5177:Vps16	UTSW	2	130443368	nonsense	probably null
R5540:Vps16	UTSW	2	130442385	missense	probably benign	0.00
R5680:Vps16	UTSW	2	130440324	missense	possibly damaging	0.64
R5689:Vps16	UTSW	2	130439091	nonsense	probably null
R5690:Vps16	UTSW	2	130439091	nonsense	probably null
R5926:Vps16	UTSW	2	130443556	missense	probably damaging	0.97
R5992:Vps16	UTSW	2	130424449	critical splice donor site	probably null
R6135:Vps16	UTSW	2	130438653	missense	possibly damaging	0.57
R6370:Vps16	UTSW	2	130443384	missense	probably damaging	1.00
R6898:Vps16	UTSW	2	130437681	missense	possibly damaging	0.74
R7378:Vps16	UTSW	2	130438179	missense	probably damaging	1.00
R7487:Vps16	UTSW	2	130439057	nonsense	probably null
R7641:Vps16	UTSW	2	130440528	missense	probably benign	0.28
R7720:Vps16	UTSW	2	130441703	nonsense	probably null
R8246:Vps16	UTSW	2	130438873	missense	probably damaging	1.00
R8363:Vps16	UTSW	2	130442241	missense	probably benign	0.08
R9092:Vps16	UTSW	2	130439673	missense	probably damaging	0.99
R9128:Vps16	UTSW	2	130424399	missense	possibly damaging	0.51
R9352:Vps16	UTSW	2	130441903	critical splice donor site	probably null
R9406:Vps16	UTSW	2	130441505	critical splice donor site	probably null
R9800:Vps16	UTSW	2	130440485	missense	probably benign	0.02
RF021:Vps16	UTSW	2	130438209	missense	probably benign	0.09
Z1177:Vps16	UTSW	2	130441426	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATGAATTTGCAGCCAAGGTTTG -3'
(R):5'- CCAATCTTCCAAATCTGCCAGG -3'

Sequencing Primer
(F):5'- AGCCAAGGTTTGACTGCC -3'
(R):5'- AGGGCAGCCAGCTTTAAC -3'

Posted On

2022-07-18