Incidental Mutation 'R9508:Vps16'
ID 717914
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock # R9508 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130424339-130444269 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 130442441 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 704 (I704N)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000028900
AA Change: I704N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: I704N

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G A 13: 119,480,948 V536I Het
4930444G20Rik A G 10: 22,066,917 V388A probably damaging Het
Adam18 A G 8: 24,653,762 I187T possibly damaging Het
Adam24 A G 8: 40,679,902 I136M probably benign Het
B3galt2 A T 1: 143,646,542 I139F possibly damaging Het
Cacna1i C T 15: 80,395,171 P2038S probably benign Het
Cbll1 A T 12: 31,494,686 I26N probably damaging Het
Cldn1 A T 16: 26,360,869 Y149* probably null Het
Cnot11 T C 1: 39,542,494 V372A probably damaging Het
Cnot2 A G 10: 116,493,711 L458P probably damaging Het
Cnot4 T C 6: 35,068,619 E219G Het
Col8a1 T G 16: 57,628,584 I188L unknown Het
Daam2 T C 17: 49,458,590 K1095R probably damaging Het
Dnah9 T C 11: 65,834,263 T4355A probably damaging Het
Dsg4 A G 18: 20,471,013 I846V probably damaging Het
Ehd4 C T 2: 120,091,485 G430E probably damaging Het
Fanci T C 7: 79,433,285 Y670H possibly damaging Het
Galnt10 T A 11: 57,782,214 N465K possibly damaging Het
Glipr1l1 A G 10: 112,076,110 N183S probably damaging Het
Gnl1 T C 17: 35,988,733 Y599H possibly damaging Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Grk2 A T 19: 4,291,608 N179K probably damaging Het
Igf2bp2 T A 16: 22,080,095 M255L probably benign Het
Ighv2-6 T C 12: 113,716,810 I70M probably benign Het
Igkv4-74 T A 6: 69,184,958 N76Y probably damaging Het
Il11ra1 T C 4: 41,767,527 V293A probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kank2 A T 9: 21,775,780 L582Q probably damaging Het
Kmt2b T C 7: 30,569,834 T2554A probably damaging Het
Mecom T A 3: 29,956,472 Y619F probably benign Het
Mknk1 A G 4: 115,875,382 N269S probably benign Het
Mpp2 T A 11: 102,060,866 E435D probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Olfr1009 A G 2: 85,721,821 R139G possibly damaging Het
Olfr452 A G 6: 42,790,994 *318W probably null Het
Olfr57 A T 10: 79,035,099 Q101L probably damaging Het
P3h3 A G 6: 124,853,049 probably null Het
Paqr5 C T 9: 61,972,797 V72M probably benign Het
Pilrb2 G A 5: 137,870,999 T113I probably damaging Het
Pitpnm3 T C 11: 72,112,295 E63G probably damaging Het
Ppp4r4 G A 12: 103,576,302 V108M possibly damaging Het
Ptprf G T 4: 118,269,579 S46* probably null Het
Rab2a T C 4: 8,582,447 L143P Het
Rassf7 C T 7: 141,217,011 R46* probably null Het
Sec23a T C 12: 58,989,399 D393G probably benign Het
Serpinb9f T A 13: 33,334,532 F338L probably benign Het
Spg7 T C 8: 123,073,884 V66A probably damaging Het
Sult2a4 C T 7: 13,989,512 R27H probably benign Het
Sumo2 A C 11: 115,523,712 Y95D possibly damaging Het
Tbx18 G A 9: 87,705,873 S397F probably damaging Het
Ticam2 G C 18: 46,560,681 P113R probably damaging Het
Timeless A G 10: 128,240,227 S63G probably benign Het
Tinag C T 9: 77,005,699 C276Y probably damaging Het
Tmem143 A T 7: 45,916,206 K364* probably null Het
Tmem160 A G 7: 16,452,915 probably benign Het
Tmod4 G C 3: 95,127,402 E154Q probably benign Het
Trpv1 G T 11: 73,254,264 K725N Het
Ttn G T 2: 76,885,634 A7767D unknown Het
Tubd1 T A 11: 86,557,814 Y318N probably damaging Het
Ufd1 T A 16: 18,825,052 M187K possibly damaging Het
Unc5c A G 3: 141,788,975 N424D possibly damaging Het
Usp19 C T 9: 108,494,409 S329L probably damaging Het
Vwf A T 6: 125,555,508 I72F Het
Ypel4 T C 2: 84,736,960 S46P probably damaging Het
Zcchc8 A C 5: 123,704,521 probably null Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
R9092:Vps16 UTSW 2 130439673 missense probably damaging 0.99
R9128:Vps16 UTSW 2 130424399 missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130441903 critical splice donor site probably null
R9406:Vps16 UTSW 2 130441505 critical splice donor site probably null
R9800:Vps16 UTSW 2 130440485 missense probably benign 0.02
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGAATTTGCAGCCAAGGTTTG -3'
(R):5'- CCAATCTTCCAAATCTGCCAGG -3'

Sequencing Primer
(F):5'- AGCCAAGGTTTGACTGCC -3'
(R):5'- AGGGCAGCCAGCTTTAAC -3'
Posted On 2022-07-18