Incidental Mutation 'R5540:Vps16'
ID435860
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene NameVSP16 CORVET/HOPS core subunit
Synonyms
MMRRC Submission 043098-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R5540 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130424339-130444269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130442385 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 685 (D685E)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
Predicted Effect probably benign
Transcript: ENSMUST00000028900
AA Change: D685E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: D685E

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125973
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137084
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,362,947 S15P probably damaging Het
Actl7a A T 4: 56,744,388 H305L probably benign Het
Adam26b C A 8: 43,521,617 C116F probably damaging Het
Adgrl2 A G 3: 148,837,562 probably null Het
Akr1b10 A G 6: 34,394,112 T238A probably damaging Het
Akr1c18 A G 13: 4,137,179 V186A probably benign Het
Alpk3 G A 7: 81,095,436 V1311M probably damaging Het
Aox1 A G 1: 58,104,410 N1229S probably benign Het
Apobec3 T A 15: 79,897,919 N43K probably benign Het
Arid1a A C 4: 133,680,454 D2247E unknown Het
Asph A G 4: 9,635,906 L77S probably damaging Het
Cd300ld T A 11: 114,987,405 T94S probably damaging Het
Celf2 T C 2: 6,553,932 T382A probably benign Het
Cfap54 C T 10: 92,972,608 A1402T possibly damaging Het
Chrnb1 A T 11: 69,795,650 V48E probably benign Het
Col6a5 T A 9: 105,862,776 E2548V probably benign Het
Crebrf A G 17: 26,742,097 D56G possibly damaging Het
Dctn5 A G 7: 122,135,052 T40A probably benign Het
Dmxl2 A T 9: 54,393,857 N2323K probably benign Het
Dync1h1 A G 12: 110,660,950 Q4021R probably benign Het
Dyrk1a T G 16: 94,685,343 probably null Het
Ephb3 T A 16: 21,220,860 F454Y probably damaging Het
Fam71b A G 11: 46,404,888 N29S probably damaging Het
Fbxo38 A G 18: 62,514,793 probably null Het
Flg T C 3: 93,277,616 F15S probably damaging Het
Fndc3b G A 3: 27,501,502 P301L probably damaging Het
Fpr-rs7 C T 17: 20,114,094 G45R probably damaging Het
Gfi1 T A 5: 107,720,125 T360S probably damaging Het
Grik4 T C 9: 42,520,947 H918R probably damaging Het
Hpx A G 7: 105,591,912 S385P possibly damaging Het
Kdm5b A G 1: 134,631,241 D1501G probably damaging Het
Kif20b A T 19: 34,938,460 M546L probably benign Het
Map3k9 G T 12: 81,772,813 N222K probably damaging Het
Me1 A G 9: 86,679,873 L53P possibly damaging Het
Mis18bp1 T C 12: 65,148,746 E748G possibly damaging Het
Morc3 T A 16: 93,847,380 N186K probably benign Het
Mtor A G 4: 148,454,708 T221A probably benign Het
Muc6 A G 7: 141,649,585 probably null Het
Myh8 C A 11: 67,286,440 T444N probably benign Het
Myo7b A G 18: 32,007,090 Y216H probably damaging Het
Myom1 G A 17: 71,109,787 V1382M probably damaging Het
Nbeal2 A T 9: 110,631,733 Y1718N probably damaging Het
Npc1l1 A G 11: 6,214,546 S1168P probably damaging Het
Olfr1431 T A 19: 12,210,460 I298N probably damaging Het
Olfr463 T A 11: 87,893,685 K80* probably null Het
Olfr48 A G 2: 89,844,667 F102S probably damaging Het
Olfr561 C T 7: 102,774,929 A135V probably benign Het
Olfr765 G T 10: 129,046,495 D189E probably damaging Het
Pcdha4 C A 18: 36,954,837 A691E probably benign Het
Pde6a T G 18: 61,231,366 F165V probably damaging Het
Pqlc2 A T 4: 139,300,344 L229Q probably damaging Het
Ptpn14 A T 1: 189,846,364 M340L probably benign Het
Rnasel G T 1: 153,755,144 E469* probably null Het
Rsph3a T G 17: 7,945,958 L50R probably benign Het
Rusc2 A G 4: 43,423,975 Y1043C probably damaging Het
Serpinb6b A T 13: 32,977,558 K86* probably null Het
Serpine1 T C 5: 137,063,209 T392A probably benign Het
Shcbp1 A T 8: 4,744,529 D421E probably damaging Het
Slc24a1 A G 9: 64,948,581 V348A unknown Het
Slc26a7 A G 4: 14,506,621 F605L probably benign Het
Spag17 A C 3: 100,056,272 E1102A possibly damaging Het
Stab2 A G 10: 86,848,125 V2390A probably benign Het
Stk11 A G 10: 80,126,049 I35V probably benign Het
Stk24 T C 14: 121,294,281 D321G possibly damaging Het
Tbx4 A T 11: 85,911,168 N209I possibly damaging Het
Tmem225 T C 9: 40,149,385 L80P probably damaging Het
Tnfrsf4 C T 4: 156,013,923 T17I probably benign Het
Traf3ip1 G A 1: 91,501,315 R268Q probably benign Het
Trhde T A 10: 114,800,592 I237F probably benign Het
Ugt2a1 A T 5: 87,486,056 W231R probably damaging Het
Vash1 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 12: 86,680,057 probably benign Het
Washc4 A G 10: 83,573,793 D602G probably damaging Het
Wdr59 A G 8: 111,485,184 L377P possibly damaging Het
Wdr81 T C 11: 75,449,070 E1364G probably damaging Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGATGCCTTCTACAAAGC -3'
(R):5'- GCCAGCTTTAACCACCATAGTC -3'

Sequencing Primer
(F):5'- GCCAAGAATGAATTTGCAGCC -3'
(R):5'- TCTGCAGGAAAGCTGTACTC -3'
Posted On2016-10-24