Mutagenetix > Incidental Mutation

Incidental Mutation 'R5540:Vps16'

435860

Institutional Source

Beutler Lab

Gene Symbol

Vps16

Ensembl Gene

ENSMUSG00000027411

Gene Name

VSP16 CORVET/HOPS core subunit

Synonyms

MMRRC Submission

043098-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R5540 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

130424339-130444269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 130442385 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 685 (D685E)

Ref Sequence

ENSEMBL: ENSMUSP00000028900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000028900
AA Change: D685E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: D685E

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	420	1e-166	PFAM
low complexity region	452	462	N/A	INTRINSIC
Pfam:Vps16_C	517	835	5.5e-150	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125973

Predicted Effect

probably benign
Transcript: ENSMUST00000128994

SMART Domains

Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	212	3.2e-74	PFAM
Pfam:Vps16_N	205	316	1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130258

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131220

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134677

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137084

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008O03Rik	A	G	7: 44,362,947	S15P	probably damaging	Het
Actl7a	A	T	4: 56,744,388	H305L	probably benign	Het
Adam26b	C	A	8: 43,521,617	C116F	probably damaging	Het
Adgrl2	A	G	3: 148,837,562		probably null	Het
Akr1b10	A	G	6: 34,394,112	T238A	probably damaging	Het
Akr1c18	A	G	13: 4,137,179	V186A	probably benign	Het
Alpk3	G	A	7: 81,095,436	V1311M	probably damaging	Het
Aox1	A	G	1: 58,104,410	N1229S	probably benign	Het
Apobec3	T	A	15: 79,897,919	N43K	probably benign	Het
Arid1a	A	C	4: 133,680,454	D2247E	unknown	Het
Asph	A	G	4: 9,635,906	L77S	probably damaging	Het
Cd300ld	T	A	11: 114,987,405	T94S	probably damaging	Het
Celf2	T	C	2: 6,553,932	T382A	probably benign	Het
Cfap54	C	T	10: 92,972,608	A1402T	possibly damaging	Het
Chrnb1	A	T	11: 69,795,650	V48E	probably benign	Het
Col6a5	T	A	9: 105,862,776	E2548V	probably benign	Het
Crebrf	A	G	17: 26,742,097	D56G	possibly damaging	Het
Dctn5	A	G	7: 122,135,052	T40A	probably benign	Het
Dmxl2	A	T	9: 54,393,857	N2323K	probably benign	Het
Dync1h1	A	G	12: 110,660,950	Q4021R	probably benign	Het
Dyrk1a	T	G	16: 94,685,343		probably null	Het
Ephb3	T	A	16: 21,220,860	F454Y	probably damaging	Het
Fam71b	A	G	11: 46,404,888	N29S	probably damaging	Het
Fbxo38	A	G	18: 62,514,793		probably null	Het
Flg	T	C	3: 93,277,616	F15S	probably damaging	Het
Fndc3b	G	A	3: 27,501,502	P301L	probably damaging	Het
Fpr-rs7	C	T	17: 20,114,094	G45R	probably damaging	Het
Gfi1	T	A	5: 107,720,125	T360S	probably damaging	Het
Grik4	T	C	9: 42,520,947	H918R	probably damaging	Het
Hpx	A	G	7: 105,591,912	S385P	possibly damaging	Het
Kdm5b	A	G	1: 134,631,241	D1501G	probably damaging	Het
Kif20b	A	T	19: 34,938,460	M546L	probably benign	Het
Map3k9	G	T	12: 81,772,813	N222K	probably damaging	Het
Me1	A	G	9: 86,679,873	L53P	possibly damaging	Het
Mis18bp1	T	C	12: 65,148,746	E748G	possibly damaging	Het
Morc3	T	A	16: 93,847,380	N186K	probably benign	Het
Mtor	A	G	4: 148,454,708	T221A	probably benign	Het
Muc6	A	G	7: 141,649,585		probably null	Het
Myh8	C	A	11: 67,286,440	T444N	probably benign	Het
Myo7b	A	G	18: 32,007,090	Y216H	probably damaging	Het
Myom1	G	A	17: 71,109,787	V1382M	probably damaging	Het
Nbeal2	A	T	9: 110,631,733	Y1718N	probably damaging	Het
Npc1l1	A	G	11: 6,214,546	S1168P	probably damaging	Het
Olfr1431	T	A	19: 12,210,460	I298N	probably damaging	Het
Olfr463	T	A	11: 87,893,685	K80*	probably null	Het
Olfr48	A	G	2: 89,844,667	F102S	probably damaging	Het
Olfr561	C	T	7: 102,774,929	A135V	probably benign	Het
Olfr765	G	T	10: 129,046,495	D189E	probably damaging	Het
Pcdha4	C	A	18: 36,954,837	A691E	probably benign	Het
Pde6a	T	G	18: 61,231,366	F165V	probably damaging	Het
Pqlc2	A	T	4: 139,300,344	L229Q	probably damaging	Het
Ptpn14	A	T	1: 189,846,364	M340L	probably benign	Het
Rnasel	G	T	1: 153,755,144	E469*	probably null	Het
Rsph3a	T	G	17: 7,945,958	L50R	probably benign	Het
Rusc2	A	G	4: 43,423,975	Y1043C	probably damaging	Het
Serpinb6b	A	T	13: 32,977,558	K86*	probably null	Het
Serpine1	T	C	5: 137,063,209	T392A	probably benign	Het
Shcbp1	A	T	8: 4,744,529	D421E	probably damaging	Het
Slc24a1	A	G	9: 64,948,581	V348A	unknown	Het
Slc26a7	A	G	4: 14,506,621	F605L	probably benign	Het
Spag17	A	C	3: 100,056,272	E1102A	possibly damaging	Het
Stab2	A	G	10: 86,848,125	V2390A	probably benign	Het
Stk11	A	G	10: 80,126,049	I35V	probably benign	Het
Stk24	T	C	14: 121,294,281	D321G	possibly damaging	Het
Tbx4	A	T	11: 85,911,168	N209I	possibly damaging	Het
Tmem225	T	C	9: 40,149,385	L80P	probably damaging	Het
Tnfrsf4	C	T	4: 156,013,923	T17I	probably benign	Het
Traf3ip1	G	A	1: 91,501,315	R268Q	probably benign	Het
Trhde	T	A	10: 114,800,592	I237F	probably benign	Het
Ugt2a1	A	T	5: 87,486,056	W231R	probably damaging	Het
Vash1	ACTGCTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGC	12: 86,680,057		probably benign	Het
Washc4	A	G	10: 83,573,793	D602G	probably damaging	Het
Wdr59	A	G	8: 111,485,184	L377P	possibly damaging	Het
Wdr81	T	C	11: 75,449,070	E1364G	probably damaging	Het

Other mutations in Vps16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Vps16	APN	2	130437696	missense	probably benign	0.19
IGL01400:Vps16	APN	2	130438353	missense	possibly damaging	0.73
IGL01542:Vps16	APN	2	130438394	missense	probably damaging	0.97
IGL02011:Vps16	APN	2	130441479	missense	probably benign	0.04
IGL02192:Vps16	APN	2	130440932	missense	probably damaging	0.98
IGL02220:Vps16	APN	2	130441653	missense	possibly damaging	0.85
IGL02587:Vps16	APN	2	130439716	critical splice donor site	probably null
R0427:Vps16	UTSW	2	130438850	missense	probably benign	0.00
R0507:Vps16	UTSW	2	130437712	critical splice donor site	probably null
R1550:Vps16	UTSW	2	130440340	missense	probably benign	0.09
R1789:Vps16	UTSW	2	130443600	missense	probably benign	0.42
R3895:Vps16	UTSW	2	130438676	missense	possibly damaging	0.96
R3981:Vps16	UTSW	2	130442594	missense	possibly damaging	0.77
R4092:Vps16	UTSW	2	130439912	missense	probably damaging	1.00
R4555:Vps16	UTSW	2	130443576	missense	probably damaging	1.00
R4569:Vps16	UTSW	2	130442204	missense	probably benign
R4803:Vps16	UTSW	2	130438110	missense	probably benign	0.27
R4835:Vps16	UTSW	2	130438300	splice site	probably benign
R5022:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5023:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5057:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5158:Vps16	UTSW	2	130441279	missense	probably damaging	1.00
R5177:Vps16	UTSW	2	130443368	nonsense	probably null
R5680:Vps16	UTSW	2	130440324	missense	possibly damaging	0.64
R5689:Vps16	UTSW	2	130439091	nonsense	probably null
R5690:Vps16	UTSW	2	130439091	nonsense	probably null
R5926:Vps16	UTSW	2	130443556	missense	probably damaging	0.97
R5992:Vps16	UTSW	2	130424449	critical splice donor site	probably null
R6135:Vps16	UTSW	2	130438653	missense	possibly damaging	0.57
R6370:Vps16	UTSW	2	130443384	missense	probably damaging	1.00
R6898:Vps16	UTSW	2	130437681	missense	possibly damaging	0.74
R7378:Vps16	UTSW	2	130438179	missense	probably damaging	1.00
R7487:Vps16	UTSW	2	130439057	nonsense	probably null
R7641:Vps16	UTSW	2	130440528	missense	probably benign	0.28
R7720:Vps16	UTSW	2	130441703	nonsense	probably null
R8246:Vps16	UTSW	2	130438873	missense	probably damaging	1.00
R8363:Vps16	UTSW	2	130442241	missense	probably benign	0.08
R9092:Vps16	UTSW	2	130439673	missense	probably damaging	0.99
R9128:Vps16	UTSW	2	130424399	missense	possibly damaging	0.51
R9352:Vps16	UTSW	2	130441903	critical splice donor site	probably null
R9406:Vps16	UTSW	2	130441505	critical splice donor site	probably null
R9508:Vps16	UTSW	2	130442441	missense	possibly damaging	0.94
R9800:Vps16	UTSW	2	130440485	missense	probably benign	0.02
RF021:Vps16	UTSW	2	130438209	missense	probably benign	0.09
Z1177:Vps16	UTSW	2	130441426	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCTGATGCCTTCTACAAAGC -3'
(R):5'- GCCAGCTTTAACCACCATAGTC -3'

Sequencing Primer
(F):5'- GCCAAGAATGAATTTGCAGCC -3'
(R):5'- TCTGCAGGAAAGCTGTACTC -3'

Posted On

2016-10-24