Mutagenetix > Incidental Mutations

Incidental Mutation 'R0427:Vps16'

38720

Institutional Source

Beutler Lab

Gene Symbol

Vps16

Ensembl Gene

ENSMUSG00000027411

Gene Name

VSP16 CORVET/HOPS core subunit

Synonyms

MMRRC Submission

038629-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R0427 (G1)

Quality Score

198

Status

Not validated

Chromosome

Chromosomal Location

130424339-130444269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 130438850 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 233 (Y233C)

Ref Sequence

ENSEMBL: ENSMUSP00000028900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]

Predicted Effect

probably benign
Transcript: ENSMUST00000028900
AA Change: Y233C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: Y233C

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	420	1e-166	PFAM
low complexity region	452	462	N/A	INTRINSIC
Pfam:Vps16_C	517	835	5.5e-150	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125973

Predicted Effect

probably benign
Transcript: ENSMUST00000128994

SMART Domains

Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	212	3.2e-74	PFAM
Pfam:Vps16_N	205	316	1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130258

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131220

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134677

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137084

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	T	G	8: 43,652,456	T51P	probably benign	Het
Alpk1	A	T	3: 127,671,071	V1186E	probably damaging	Het
Ankfn1	T	C	11: 89,405,597	D102G	probably damaging	Het
Armc2	A	G	10: 42,000,410	I127T	possibly damaging	Het
Atp6v1b2	T	C	8: 69,101,432	L87P	probably damaging	Het
Atp9a	T	A	2: 168,640,697		probably null	Het
BC048679	C	G	7: 81,495,245	V123L	probably benign	Het
Birc7	G	A	2: 180,929,514		probably null	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
Cacna1d	T	A	14: 30,346,817	N155I	probably damaging	Het
Cd300lg	T	C	11: 102,043,026	V33A	probably damaging	Het
Cep290	A	G	10: 100,516,179	D742G	probably benign	Het
Cep95	A	G	11: 106,790,752	N14S	probably benign	Het
Cfap74	A	T	4: 155,441,277	M728L	probably benign	Het
Ctsll3	T	A	13: 60,801,391	T9S	probably benign	Het
Cyp3a44	A	G	5: 145,779,602	S393P	possibly damaging	Het
Dmbt1	T	A	7: 131,040,902	L150*	probably null	Het
Dnah2	A	G	11: 69,452,879	I2868T	probably damaging	Het
Dopey1	A	G	9: 86,507,532	H505R	probably damaging	Het
Exo1	A	G	1: 175,905,953	K781R	probably damaging	Het
Fam184a	A	G	10: 53,690,115	Y459H	probably damaging	Het
Foxp1	C	T	6: 98,930,203	D540N	probably damaging	Het
Fstl5	T	A	3: 76,707,727	Y698*	probably null	Het
Gm13088	A	T	4: 143,654,423	N343K	probably benign	Het
Gm5141	T	C	13: 62,774,711	K215E	probably damaging	Het
Gm7102	A	G	19: 61,175,470	Y176H	probably damaging	Het
Grik5	C	A	7: 25,058,498	R386L	probably benign	Het
Ikbke	A	T	1: 131,257,910	S620R	possibly damaging	Het
Kcnh3	A	T	15: 99,233,299	M518L	probably benign	Het
Lrrcc1	G	T	3: 14,558,356	A748S	probably damaging	Het
Mbd5	T	G	2: 49,279,079	S1191A	probably benign	Het
Med27	T	C	2: 29,500,271	I70T	probably damaging	Het
Myh4	A	G	11: 67,258,653	D1737G	probably damaging	Het
Myo5a	A	G	9: 75,174,196	D1021G	probably benign	Het
Ncor1	T	C	11: 62,410,920	E212G	probably damaging	Het
Neb	A	T	2: 52,243,884	N3362K	possibly damaging	Het
Neb	A	G	2: 52,244,069	S3301P	probably damaging	Het
Neurod1	T	G	2: 79,454,182	K286Q	probably damaging	Het
Noc3l	T	C	19: 38,789,651	Q773R	probably benign	Het
Nup205	T	A	6: 35,194,463	N420K	probably benign	Het
Olfml3	A	T	3: 103,737,014	V113E	probably benign	Het
Olfr108	T	A	17: 37,445,702	D60E	probably damaging	Het
Olfr128	A	T	17: 37,923,629	H21L	probably benign	Het
Olfr155	A	G	4: 43,854,417	Y36C	probably damaging	Het
Olfr342	C	T	2: 36,527,982	S190L	probably damaging	Het
Opa1	T	C	16: 29,611,461	V439A	probably damaging	Het
Pcdhb11	T	C	18: 37,422,765	S383P	probably damaging	Het
Pkd1	T	C	17: 24,593,502	V3803A	probably damaging	Het
Plekhg1	A	G	10: 3,964,235	D1319G	probably benign	Het
Polq	T	A	16: 37,061,993	C1227*	probably null	Het
Psmc1	T	C	12: 100,119,228	F283L	probably damaging	Het
Psmd8	T	C	7: 29,176,127	N189S	probably damaging	Het
Ptger4	G	A	15: 5,242,901	T104I	probably benign	Het
Ptpro	T	G	6: 137,368,296	V100G	possibly damaging	Het
Rab11fip1	T	A	8: 27,154,492	T422S	probably damaging	Het
Rad54l2	A	G	9: 106,693,692	L1143P	possibly damaging	Het
Rnf148	A	G	6: 23,654,073	M308T	probably damaging	Het
Sbsn	T	A	7: 30,752,098		probably benign	Het
Scube2	T	A	7: 109,824,837	T487S	probably benign	Het
Sema4c	C	A	1: 36,553,811	E109*	probably null	Het
Sipa1l2	A	T	8: 125,480,332	L544Q	probably damaging	Het
Slc28a2	A	G	2: 122,458,221	T603A	probably benign	Het
Tbc1d7	T	A	13: 43,153,087	T138S	probably benign	Het
Timd4	A	T	11: 46,819,257	T239S	probably benign	Het
Trp53bp1	A	G	2: 121,236,017	S743P	probably damaging	Het
Tspan10	T	A	11: 120,444,294	Y77N	probably damaging	Het
Ttc14	T	C	3: 33,803,484	S245P	probably damaging	Het
Ttf1	T	A	2: 29,065,042	S139R	probably benign	Het
Tubd1	C	A	11: 86,557,790	Q279K	possibly damaging	Het
Twnk	A	G	19: 45,007,587	E153G	probably benign	Het
Ush2a	A	G	1: 188,400,281	D900G	probably damaging	Het
Usp54	A	G	14: 20,570,364	V691A	probably benign	Het
Usp8	T	C	2: 126,718,032		probably benign	Het
Vmn1r231	C	T	17: 20,890,228	V142I	probably benign	Het
Vmn2r15	C	T	5: 109,287,087	A584T	probably damaging	Het
Vmn2r6	A	G	3: 64,559,587	S164P	probably damaging	Het
Vwf	C	G	6: 125,673,939	H2511D	probably benign	Het
Wipf3	T	G	6: 54,483,897	L110R	possibly damaging	Het
Zfp945	T	A	17: 22,865,252	N11I	probably benign	Het

Other mutations in Vps16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Vps16	APN	2	130437696	missense	probably benign	0.19
IGL01400:Vps16	APN	2	130438353	missense	possibly damaging	0.73
IGL01542:Vps16	APN	2	130438394	missense	probably damaging	0.97
IGL02011:Vps16	APN	2	130441479	missense	probably benign	0.04
IGL02192:Vps16	APN	2	130440932	missense	probably damaging	0.98
IGL02220:Vps16	APN	2	130441653	missense	possibly damaging	0.85
IGL02587:Vps16	APN	2	130439716	critical splice donor site	probably null
R0507:Vps16	UTSW	2	130437712	critical splice donor site	probably null
R1550:Vps16	UTSW	2	130440340	missense	probably benign	0.09
R1789:Vps16	UTSW	2	130443600	missense	probably benign	0.42
R3895:Vps16	UTSW	2	130438676	missense	possibly damaging	0.96
R3981:Vps16	UTSW	2	130442594	missense	possibly damaging	0.77
R4092:Vps16	UTSW	2	130439912	missense	probably damaging	1.00
R4555:Vps16	UTSW	2	130443576	missense	probably damaging	1.00
R4569:Vps16	UTSW	2	130442204	missense	probably benign
R4803:Vps16	UTSW	2	130438110	missense	probably benign	0.27
R4835:Vps16	UTSW	2	130438300	splice site	probably benign
R5022:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5023:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5057:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5158:Vps16	UTSW	2	130441279	missense	probably damaging	1.00
R5177:Vps16	UTSW	2	130443368	nonsense	probably null
R5540:Vps16	UTSW	2	130442385	missense	probably benign	0.00
R5680:Vps16	UTSW	2	130440324	missense	possibly damaging	0.64
R5689:Vps16	UTSW	2	130439091	nonsense	probably null
R5690:Vps16	UTSW	2	130439091	nonsense	probably null
R5926:Vps16	UTSW	2	130443556	missense	probably damaging	0.97
R5992:Vps16	UTSW	2	130424449	critical splice donor site	probably null
R6135:Vps16	UTSW	2	130438653	missense	possibly damaging	0.57
R6370:Vps16	UTSW	2	130443384	missense	probably damaging	1.00
R6898:Vps16	UTSW	2	130437681	missense	possibly damaging	0.74
R7378:Vps16	UTSW	2	130438179	missense	probably damaging	1.00
R7487:Vps16	UTSW	2	130439057	nonsense	probably null
R7641:Vps16	UTSW	2	130440528	missense	probably benign	0.28
R7720:Vps16	UTSW	2	130441703	nonsense	probably null
R8246:Vps16	UTSW	2	130438873	missense	probably damaging	1.00
R8363:Vps16	UTSW	2	130442241	missense	probably benign	0.08
RF021:Vps16	UTSW	2	130438209	missense	probably benign	0.09
Z1177:Vps16	UTSW	2	130441426	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATGTTGGACCACACTGTGCC -3'
(R):5'- ACAGTCATCCTGCTGTTGAAAAGCC -3'

Sequencing Primer
(F):5'- ACACATTCTTCTGGCTGTAGGAC -3'
(R):5'- AACCACACCTTGAGTGATGC -3'

Posted On

2013-05-23