Incidental Mutation 'R7487:Vps16'
ID 580225
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock # R7487 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 130424339-130444269 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 130439057 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 255 (C255*)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000028900
AA Change: C255*
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: C255*

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128994
AA Change: C214*
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411
AA Change: C214*

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,868 D606V probably damaging Het
1700009N14Rik T A 4: 39,450,929 V45E probably damaging Het
2510009E07Rik C T 16: 21,653,729 V74M probably damaging Het
Abca2 C T 2: 25,437,903 T739M probably benign Het
Abra T C 15: 41,869,553 E39G probably damaging Het
Adam34 A T 8: 43,651,154 C485S probably damaging Het
Add2 G T 6: 86,093,450 V175F possibly damaging Het
Alk T A 17: 71,949,898 K655N probably benign Het
Ap3m1 A G 14: 21,038,039 V317A probably benign Het
Astn1 A G 1: 158,610,782 probably null Het
Atm A T 9: 53,524,354 Y219N probably benign Het
Cep128 C T 12: 90,999,630 A1068T probably benign Het
Cnksr3 T C 10: 7,135,097 Q250R probably benign Het
Cst7 A G 2: 150,577,704 T97A probably benign Het
Ctps G A 4: 120,558,800 L209F probably damaging Het
Cyp2d10 A T 15: 82,404,592 F230I probably benign Het
Daam2 T C 17: 49,486,482 N336D probably benign Het
Dchs2 T C 3: 83,356,306 S3294P probably damaging Het
Dhx36 G T 3: 62,484,202 N574K possibly damaging Het
Dock10 G T 1: 80,585,048 Q533K probably benign Het
Dync2h1 A G 9: 7,132,041 S1589P probably benign Het
Enpp3 T A 10: 24,805,923 Y295F probably benign Het
Esrrg T A 1: 188,146,423 Y234N probably benign Het
Fadd A C 7: 144,580,725 V141G probably damaging Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fam170b T A 14: 32,835,819 C204S probably damaging Het
Fam186a T A 15: 99,942,136 I2076F possibly damaging Het
Fdxacb1 G A 9: 50,770,219 V147I possibly damaging Het
Fopnl T C 16: 14,311,104 D85G probably benign Het
Frem2 C A 3: 53,654,549 V846F probably benign Het
Fry G A 5: 150,414,574 S1449N possibly damaging Het
Gucy1b2 A G 14: 62,448,223 F98L probably damaging Het
Hps1 T C 19: 42,756,261 Y658C probably damaging Het
Igkv3-9 T A 6: 70,588,522 L35Q probably damaging Het
Irx2 A G 13: 72,630,620 Y101C probably damaging Het
Kcnj11 G T 7: 46,098,841 R353S probably benign Het
Kyat3 C T 3: 142,726,194 Q228* probably null Het
Lama3 T A 18: 12,419,237 D415E probably benign Het
Lcn3 G A 2: 25,766,162 probably null Het
Lin7b T C 7: 45,369,940 E68G possibly damaging Het
Lmbr1 T A 5: 29,254,264 K379M probably benign Het
Lrig1 A G 6: 94,606,118 S1006P probably benign Het
Lrrc37a T G 11: 103,498,219 T2127P unknown Het
Map4 A G 9: 110,027,715 D151G probably damaging Het
March1 A T 8: 66,456,074 T149S probably benign Het
Msh4 A T 3: 153,863,510 F809I probably damaging Het
Muc16 G A 9: 18,584,799 P6699S possibly damaging Het
Mxi1 A T 19: 53,371,657 D270V probably damaging Het
Myh6 A T 14: 54,953,496 C907* probably null Het
Myo18b T C 5: 112,834,433 R1145G possibly damaging Het
Nkx2-6 A C 14: 69,171,940 N47H probably benign Het
Nol7 G A 13: 43,398,600 A66T probably damaging Het
Ntrk3 T C 7: 78,250,713 N626S probably damaging Het
Nwd1 A G 8: 72,666,638 Y77C unknown Het
Olfr1057 A T 2: 86,375,131 Y94N probably damaging Het
Olfr109 G T 17: 37,466,566 R120L probably damaging Het
Olfr1413 G A 1: 92,573,795 G208D possibly damaging Het
Olfr358 A C 2: 37,004,774 V280G probably damaging Het
Olfr892-ps1 A G 9: 38,190,060 S112G probably damaging Het
Otop3 A G 11: 115,345,000 D486G probably benign Het
Pak1ip1 A G 13: 41,009,255 K178R probably benign Het
Pcsk1 G A 13: 75,110,883 G259S probably benign Het
Pde6a A G 18: 61,249,960 D338G probably damaging Het
Pias4 A T 10: 81,163,972 D82E probably benign Het
Plekha5 C A 6: 140,570,333 Q771K probably benign Het
Plekhh3 C A 11: 101,165,579 A397S possibly damaging Het
Prg4 G T 1: 150,455,905 T339N unknown Het
Prss22 A T 17: 23,997,997 I3N probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rspo2 T C 15: 43,078,114 T138A probably benign Het
Rtcb C T 10: 85,953,469 G70S probably benign Het
Selenov A T 7: 28,290,378 S234T probably damaging Het
Shtn1 T C 19: 59,003,860 T429A probably damaging Het
Slc4a3 G T 1: 75,553,377 R622L probably benign Het
Smc2 T C 4: 52,478,448 I1015T probably damaging Het
Spata9 G T 13: 75,967,840 V3F possibly damaging Het
Tlr4 T C 4: 66,924,422 I105T probably benign Het
Trav6d-4 A T 14: 52,753,639 Y47F possibly damaging Het
Ttn A T 2: 76,827,033 I12450N unknown Het
Umad1 G T 6: 8,270,560 A21S probably damaging Het
Unc5a G A 13: 54,996,549 R229H probably benign Het
Vmn1r216 A T 13: 23,099,860 M238L probably damaging Het
Wdr89 A G 12: 75,632,614 F289L probably benign Het
Zfp180 A T 7: 24,106,100 H648L probably damaging Het
Zfp735 A G 11: 73,690,328 K64E possibly damaging Het
Zfp990 G A 4: 145,537,587 C385Y probably damaging Het
Zswim3 G T 2: 164,820,215 S205I probably damaging Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
R9092:Vps16 UTSW 2 130439673 missense probably damaging 0.99
R9128:Vps16 UTSW 2 130424399 missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130441903 critical splice donor site probably null
R9406:Vps16 UTSW 2 130441505 critical splice donor site probably null
R9508:Vps16 UTSW 2 130442441 missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130440485 missense probably benign 0.02
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTCTTCACAGACACAGG -3'
(R):5'- TGGCCCATAGAGGACAAAGTTC -3'

Sequencing Primer
(F):5'- CACAGGCTACATCTGGATGG -3'
(R):5'- TCTCCTTTAAGTGCAGCAGAG -3'
Posted On 2019-10-07