Mutagenetix > Incidental Mutation

Incidental Mutation 'R9786:Stab2'

734346

Institutional Source

Beutler Lab

Gene Symbol

Stab2

Ensembl Gene

ENSMUSG00000035459

Gene Name

stabilin 2

Synonyms

STAB-2, FEEL-2

MMRRC Submission

Accession Numbers

Genbank: NM_138673; MGI: 2178743

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9786 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86841198-87008025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 86922133 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 1090 (M1090I)

Ref Sequence

ENSEMBL: ENSMUSP00000048309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035288]

AlphaFold

Q8R4U0

Predicted Effect

probably benign
Transcript: ENSMUST00000035288
AA Change: M1090I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: M1090I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EGF	119	156	1.85e0	SMART
EGF	167	201	2.43e1	SMART
EGF	206	244	1.43e-1	SMART
EGF	248	284	3.82e-2	SMART
EGF	333	370	2.02e-1	SMART
FAS1	414	515	1.06e-8	SMART
FAS1	561	662	3.54e-19	SMART
EGF	746	783	6.76e-3	SMART
EGF	836	873	1.31e0	SMART
EGF	877	917	2.99e-4	SMART
EGF	921	960	3.51e-1	SMART
EGF	964	1002	1.99e0	SMART
FAS1	1038	1138	1.73e-13	SMART
FAS1	1181	1276	1.83e-12	SMART
EGF	1354	1391	6.92e0	SMART
EGF	1401	1435	1.11e1	SMART
EGF	1442	1477	3.01e0	SMART
EGF	1481	1519	1.64e-1	SMART
EGF	1523	1561	1.14e0	SMART
EGF	1565	1603	5.62e0	SMART
FAS1	1638	1734	2.23e-25	SMART
FAS1	1785	1891	6.92e-22	SMART
EGF	1966	2006	1.95e1	SMART
EGF_like	1977	2017	2.46e-1	SMART
EGF	2016	2050	1.14e0	SMART
EGF	2058	2089	1.56e1	SMART
EGF	2093	2130	1.36e1	SMART
EGF	2134	2173	2.13e0	SMART
LINK	2204	2298	2.08e-29	SMART
FAS1	2363	2455	3.19e-12	SMART
transmembrane domain	2467	2489	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.2%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	C	T	13: 59,742,684	D441N	possibly damaging	Het
A4gnt	T	A	9: 99,620,483	M232K	possibly damaging	Het
Abcc1	T	C	16: 14,405,063	S243P	probably damaging	Het
Acsl1	T	C	8: 46,521,449	Y320H	probably damaging	Het
Adam11	A	G	11: 102,762,264	S61G	probably benign	Het
Adamts1	G	A	16: 85,795,414	T965I	probably benign	Het
Adcyap1r1	T	A	6: 55,479,197	M190K	probably damaging	Het
Ankrd2	T	A	19: 42,044,919	L300Q		Het
Ankrd27	A	T	7: 35,591,869	Q30L	possibly damaging	Het
Atp8b5	T	A	4: 43,305,798	I114K	probably damaging	Het
Atrn	A	T	2: 130,944,889	I205F	probably damaging	Het
BC035947	A	G	1: 78,511,924		probably benign	Het
Boc	C	T	16: 44,491,329	R677H		Het
D3Ertd254e	T	A	3: 36,165,704	C625*	probably null	Het
Dpysl3	G	T	18: 43,329,857	T485K	probably damaging	Het
Esyt3	T	C	9: 99,311,985	D867G	possibly damaging	Het
Fam178b	G	A	1: 36,564,436	T478I	probably damaging	Het
Fam26f	A	G	10: 34,127,647	F88S	probably benign	Het
Foxd2	G	T	4: 114,907,653	T390K	possibly damaging	Het
Furin	A	G	7: 80,390,897	V731A	probably benign	Het
Gm6583	T	A	5: 112,355,073	E255V	probably benign	Het
Grin2a	T	A	16: 9,653,602	I601F	possibly damaging	Het
Hat1	G	A	2: 71,420,615	R169Q	possibly damaging	Het
Ighe	G	C	12: 113,273,231	Q6E		Het
Ighv8-2	T	C	12: 114,462,559	I31V	probably benign	Het
Klk1	A	G	7: 44,228,680	D120G	probably damaging	Het
Kmt2e	A	G	5: 23,497,984	D1054G	probably benign	Het
Lamp5	A	T	2: 136,069,078	I244F	probably damaging	Het
Mcm5	C	T	8: 75,117,540	S313F	probably benign	Het
Mfsd4b1	T	C	10: 40,002,869	E344G	probably damaging	Het
Mns1	A	G	9: 72,439,274	K13R	probably benign	Het
Mrpl43	C	T	19: 45,005,907	S91N	probably benign	Het
Mtbp	T	C	15: 55,617,636	S706P	probably benign	Het
Nelfb	A	T	2: 25,205,133	V348D	probably damaging	Het
Olfr1049	G	A	2: 86,255,084	S203L	probably benign	Het
Olfr281	T	C	15: 98,456,832	I174T	possibly damaging	Het
Olfr355	T	A	2: 36,927,404	K237*	probably null	Het
Olfr497	A	T	7: 108,422,717	I49F	probably benign	Het
Olfr835	C	T	9: 19,035,945	A274V	possibly damaging	Het
Pde6c	T	C	19: 38,151,561	I324T	possibly damaging	Het
Phlpp2	T	A	8: 109,934,023	L770*	probably null	Het
Pik3c2b	T	A	1: 133,091,600	F1029I	possibly damaging	Het
Rfx2	A	T	17: 56,780,890	S500R	probably benign	Het
Sarm1	T	C	11: 78,474,917	M761V	probably benign	Het
Serpina1a	A	G	12: 103,855,881	L264P	possibly damaging	Het
Slc37a1	G	T	17: 31,337,991	G377V	probably damaging	Het
Slc38a4	T	A	15: 97,008,497	M364L	probably damaging	Het
Slc7a15	A	G	12: 8,530,280	F384S	probably benign	Het
Smyd4	T	C	11: 75,390,799	V366A	probably benign	Het
Spata31d1b	T	A	13: 59,718,341	V1101D	possibly damaging	Het
Tex15	C	T	8: 33,572,429	T903I	probably damaging	Het
Tgds	A	T	14: 118,130,637	Y41*	probably null	Het
Tle4	G	T	19: 14,517,940	H142N	probably benign	Het
Tlx2	T	C	6: 83,069,293		probably null	Het
Tmem151a	C	G	19: 5,081,841	A446P	probably damaging	Het
Tmem205	A	T	9: 21,921,200	D138E	probably damaging	Het
Tmem57	A	T	4: 134,830,682	Y173*	probably null	Het
Tmprss9	A	G	10: 80,898,208	K1009E	unknown	Het
Tnk2	T	A	16: 32,680,057	C729*	probably null	Het
Trim46	T	A	3: 89,235,092	D696V	probably damaging	Het
Tuba3b	G	A	6: 145,618,756	R84Q	probably benign	Het
Unc119b	C	T	5: 115,125,462	D228N	probably damaging	Het
Usp17la	A	G	7: 104,861,657	T490A	probably benign	Het
Zfp687	C	T	3: 95,012,457	M1I	probably null	Het
Zfp729a	T	C	13: 67,620,509	T534A	possibly damaging	Het
Zfp985	A	T	4: 147,583,590	H305L	probably benign	Het
Zscan10	C	T	17: 23,609,356	Q291*	probably null	Het

Other mutations in Stab2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Stab2	APN	10	86869206	splice site	probably null
IGL00809:Stab2	APN	10	86848174	splice site	probably benign
IGL00911:Stab2	APN	10	86969753	missense	probably damaging	1.00
IGL01347:Stab2	APN	10	86901703	splice site	probably null
IGL01411:Stab2	APN	10	86980008	splice site	probably benign
IGL01503:Stab2	APN	10	86940613	splice site	probably benign
IGL01599:Stab2	APN	10	86922895	missense	probably damaging	1.00
IGL01635:Stab2	APN	10	86981128	missense	probably benign	0.04
IGL01640:Stab2	APN	10	86954171	missense	probably benign	0.09
IGL01671:Stab2	APN	10	86969277	missense	possibly damaging	0.80
IGL02023:Stab2	APN	10	86871831	missense	possibly damaging	0.67
IGL02075:Stab2	APN	10	86967650	missense	possibly damaging	0.71
IGL02174:Stab2	APN	10	86859742	splice site	probably null
IGL02600:Stab2	APN	10	86954259	missense	probably damaging	1.00
IGL02666:Stab2	APN	10	86850902	missense	possibly damaging	0.67
IGL02668:Stab2	APN	10	86846163	splice site	probably benign
IGL02709:Stab2	APN	10	86846165	splice site	probably benign
IGL02728:Stab2	APN	10	86856556	missense	possibly damaging	0.95
IGL02803:Stab2	APN	10	86950269	splice site	probably benign
IGL02938:Stab2	APN	10	86871921	missense	possibly damaging	0.77
IGL03033:Stab2	APN	10	86996803	critical splice donor site	probably null
IGL03238:Stab2	APN	10	86855121	missense	probably damaging	1.00
IGL03402:Stab2	APN	10	86969301	missense	probably benign	0.03
prospector	UTSW	10	86901567	splice site	probably null
songbird	UTSW	10	86858152	missense	probably damaging	1.00
3-1:Stab2	UTSW	10	86869177	missense	probably damaging	0.96
F6893:Stab2	UTSW	10	86855171	missense	probably damaging	1.00
K7371:Stab2	UTSW	10	86943289	critical splice donor site	probably null
PIT4142001:Stab2	UTSW	10	86867175	missense	possibly damaging	0.94
PIT4362001:Stab2	UTSW	10	86861435	nonsense	probably null
R0015:Stab2	UTSW	10	86843617	missense	probably benign
R0254:Stab2	UTSW	10	86897960	missense	probably benign
R0310:Stab2	UTSW	10	86967613	splice site	probably benign
R0333:Stab2	UTSW	10	86841627	missense	probably benign
R0391:Stab2	UTSW	10	86947144	missense	probably benign	0.27
R0400:Stab2	UTSW	10	86872610	missense	probably damaging	1.00
R0433:Stab2	UTSW	10	86843491	splice site	probably benign
R0440:Stab2	UTSW	10	86949928	missense	probably benign	0.23
R0743:Stab2	UTSW	10	86887895	missense	probably damaging	1.00
R0847:Stab2	UTSW	10	86969871	missense	probably benign	0.00
R0883:Stab2	UTSW	10	86924450	splice site	probably benign
R1078:Stab2	UTSW	10	86907133	splice site	probably null
R1118:Stab2	UTSW	10	86885718	splice site	probably null
R1119:Stab2	UTSW	10	86859755	missense	possibly damaging	0.51
R1179:Stab2	UTSW	10	86950301	missense	probably damaging	0.98
R1440:Stab2	UTSW	10	86861367	splice site	probably null
R1550:Stab2	UTSW	10	86878926	missense	probably benign	0.01
R1616:Stab2	UTSW	10	86885718	splice site	probably null
R1728:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1768:Stab2	UTSW	10	87003008	missense	probably damaging	1.00
R1772:Stab2	UTSW	10	86954234	missense	probably benign	0.06
R1776:Stab2	UTSW	10	86957816	missense	possibly damaging	0.92
R1784:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1892:Stab2	UTSW	10	86938049	missense	probably damaging	0.99
R1957:Stab2	UTSW	10	86861470	missense	probably benign	0.13
R1972:Stab2	UTSW	10	86960316	missense	probably damaging	0.99
R1975:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1976:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1996:Stab2	UTSW	10	87003031	missense	probably damaging	1.00
R2085:Stab2	UTSW	10	86954159	missense	probably damaging	1.00
R2149:Stab2	UTSW	10	86865040	nonsense	probably null
R2169:Stab2	UTSW	10	86887862	missense	probably damaging	1.00
R2201:Stab2	UTSW	10	86940639	missense	probably benign	0.22
R2296:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2297:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2298:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2326:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2434:Stab2	UTSW	10	86969319	missense	possibly damaging	0.78
R2519:Stab2	UTSW	10	86934840	splice site	probably benign
R2696:Stab2	UTSW	10	86861499	missense	probably benign	0.45
R2883:Stab2	UTSW	10	86967686	missense	possibly damaging	0.92
R2923:Stab2	UTSW	10	86861461	missense	probably damaging	1.00
R3711:Stab2	UTSW	10	86866708	missense	probably damaging	1.00
R3787:Stab2	UTSW	10	86969277	missense	possibly damaging	0.50
R3834:Stab2	UTSW	10	86949912	missense	possibly damaging	0.87
R3970:Stab2	UTSW	10	86878886	missense	probably damaging	0.97
R3979:Stab2	UTSW	10	86863456	missense	possibly damaging	0.56
R4003:Stab2	UTSW	10	86858124	missense	probably damaging	1.00
R4088:Stab2	UTSW	10	86922185	missense	probably damaging	1.00
R4151:Stab2	UTSW	10	87002983	missense	probably benign	0.12
R4190:Stab2	UTSW	10	86878944	missense	probably damaging	0.98
R4556:Stab2	UTSW	10	86967679	missense	possibly damaging	0.95
R4773:Stab2	UTSW	10	86907371	nonsense	probably null
R4825:Stab2	UTSW	10	86947147	missense	probably benign	0.08
R4865:Stab2	UTSW	10	86843500	splice site	probably null
R4871:Stab2	UTSW	10	86942235	missense	probably damaging	0.99
R4943:Stab2	UTSW	10	86954162	missense	probably damaging	0.99
R4981:Stab2	UTSW	10	86960223	missense	probably benign
R4994:Stab2	UTSW	10	86949907	missense	probably benign
R4999:Stab2	UTSW	10	86937909	missense	probably damaging	0.97
R5061:Stab2	UTSW	10	86907385	missense	probably damaging	1.00
R5072:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5073:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5074:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5134:Stab2	UTSW	10	86871810	splice site	probably null
R5213:Stab2	UTSW	10	86907197	missense	probably damaging	0.99
R5508:Stab2	UTSW	10	86960279	missense	probably benign	0.01
R5530:Stab2	UTSW	10	86947162	missense	probably benign	0.04
R5540:Stab2	UTSW	10	86848125	missense	probably benign	0.30
R5839:Stab2	UTSW	10	86872691	missense	probably damaging	0.97
R5949:Stab2	UTSW	10	86969849	missense	possibly damaging	0.87
R6015:Stab2	UTSW	10	86938042	missense	probably damaging	0.99
R6019:Stab2	UTSW	10	87003022	missense	probably benign	0.00
R6116:Stab2	UTSW	10	86907190	missense	probably damaging	1.00
R6131:Stab2	UTSW	10	86883778	splice site	probably null
R6209:Stab2	UTSW	10	86923003	missense	possibly damaging	0.94
R6243:Stab2	UTSW	10	86907161	missense	probably damaging	1.00
R6433:Stab2	UTSW	10	86901567	splice site	probably null
R6787:Stab2	UTSW	10	86919084	missense	probably benign	0.07
R6841:Stab2	UTSW	10	86942190	missense	probably damaging	1.00
R6873:Stab2	UTSW	10	86861366	critical splice donor site	probably null
R7025:Stab2	UTSW	10	86850837	missense	probably damaging	1.00
R7043:Stab2	UTSW	10	86870246	missense	probably damaging	0.99
R7047:Stab2	UTSW	10	86858152	missense	probably damaging	1.00
R7107:Stab2	UTSW	10	86905592	missense	possibly damaging	0.96
R7214:Stab2	UTSW	10	86899841	missense	probably damaging	0.99
R7271:Stab2	UTSW	10	87003108	splice site	probably null
R7291:Stab2	UTSW	10	86946220	missense	probably damaging	0.96
R7336:Stab2	UTSW	10	86969185	nonsense	probably null
R7432:Stab2	UTSW	10	86885683	missense	probably damaging	0.99
R7580:Stab2	UTSW	10	86869164	missense	probably benign	0.00
R7622:Stab2	UTSW	10	86873902	missense	possibly damaging	0.65
R7629:Stab2	UTSW	10	86883782	critical splice donor site	probably null
R7658:Stab2	UTSW	10	86981135	missense	probably benign	0.12
R7798:Stab2	UTSW	10	86957912	missense	probably damaging	0.98
R7835:Stab2	UTSW	10	86872619	missense	probably benign	0.06
R7845:Stab2	UTSW	10	86996894	missense	probably benign	0.09
R7863:Stab2	UTSW	10	86972881	missense	probably benign	0.30
R7885:Stab2	UTSW	10	86878912	missense	probably benign	0.03
R7904:Stab2	UTSW	10	86954192	nonsense	probably null
R7947:Stab2	UTSW	10	86846033	missense	probably benign	0.31
R7963:Stab2	UTSW	10	86848023	critical splice donor site	probably null
R8014:Stab2	UTSW	10	86850903	missense	possibly damaging	0.78
R8021:Stab2	UTSW	10	86905539	missense	possibly damaging	0.69
R8024:Stab2	UTSW	10	86846052	missense	probably benign	0.34
R8097:Stab2	UTSW	10	86869095	missense	possibly damaging	0.86
R8281:Stab2	UTSW	10	86873864	missense	probably damaging	0.98
R8462:Stab2	UTSW	10	86967734	missense	possibly damaging	0.79
R8670:Stab2	UTSW	10	86940723	missense	probably damaging	1.00
R8692:Stab2	UTSW	10	86972930	missense	probably damaging	0.99
R8744:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8745:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8782:Stab2	UTSW	10	86899821	missense	probably benign	0.00
R8875:Stab2	UTSW	10	86996864	missense	probably damaging	1.00
R8978:Stab2	UTSW	10	86949918	missense	possibly damaging	0.64
R9141:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9248:Stab2	UTSW	10	86891617	missense	probably damaging	0.98
R9326:Stab2	UTSW	10	86955146	missense	probably damaging	1.00
R9426:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9568:Stab2	UTSW	10	86863556	missense	probably damaging	1.00
R9627:Stab2	UTSW	10	86957840	missense	probably damaging	0.98
R9635:Stab2	UTSW	10	86850787	nonsense	probably null
R9648:Stab2	UTSW	10	86856697	frame shift	probably null
R9649:Stab2	UTSW	10	86856697	frame shift	probably null
R9650:Stab2	UTSW	10	86856697	frame shift	probably null
R9726:Stab2	UTSW	10	86954231	missense	probably benign	0.00
R9756:Stab2	UTSW	10	86967689	missense	possibly damaging	0.50
RF061:Stab2	UTSW	10	86866758	critical splice acceptor site	probably benign
X0023:Stab2	UTSW	10	86922198	critical splice acceptor site	probably null
X0025:Stab2	UTSW	10	86887816	missense	probably damaging	1.00
Z1176:Stab2	UTSW	10	86949914	missense	probably damaging	0.99
Z1177:Stab2	UTSW	10	86896596	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCAATCCTTGTTGCAACTG -3'
(R):5'- GACCTCCGCAAAGGCAAATG -3'

Sequencing Primer
(F):5'- TGCAACTGGGTGATGCTC -3'
(R):5'- CTCCGCAAAGGCAAATGTAAAG -3'

Posted On

2022-11-14