Mutagenetix > Incidental Mutation

Incidental Mutation 'R2519:Stab2'

254229

Institutional Source

Beutler Lab

Gene Symbol

Stab2

Ensembl Gene

ENSMUSG00000035459

Gene Name

stabilin 2

Synonyms

STAB-2, FEEL-2

MMRRC Submission

040423-MU

Accession Numbers

Genbank: NM_138673; MGI: 2178743

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2519 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86841198-87008025 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to C at 86934840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000048309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035288]

AlphaFold

Q8R4U0

Predicted Effect

probably benign
Transcript: ENSMUST00000035288

SMART Domains

Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EGF	119	156	1.85e0	SMART
EGF	167	201	2.43e1	SMART
EGF	206	244	1.43e-1	SMART
EGF	248	284	3.82e-2	SMART
EGF	333	370	2.02e-1	SMART
FAS1	414	515	1.06e-8	SMART
FAS1	561	662	3.54e-19	SMART
EGF	746	783	6.76e-3	SMART
EGF	836	873	1.31e0	SMART
EGF	877	917	2.99e-4	SMART
EGF	921	960	3.51e-1	SMART
EGF	964	1002	1.99e0	SMART
FAS1	1038	1138	1.73e-13	SMART
FAS1	1181	1276	1.83e-12	SMART
EGF	1354	1391	6.92e0	SMART
EGF	1401	1435	1.11e1	SMART
EGF	1442	1477	3.01e0	SMART
EGF	1481	1519	1.64e-1	SMART
EGF	1523	1561	1.14e0	SMART
EGF	1565	1603	5.62e0	SMART
FAS1	1638	1734	2.23e-25	SMART
FAS1	1785	1891	6.92e-22	SMART
EGF	1966	2006	1.95e1	SMART
EGF_like	1977	2017	2.46e-1	SMART
EGF	2016	2050	1.14e0	SMART
EGF	2058	2089	1.56e1	SMART
EGF	2093	2130	1.36e1	SMART
EGF	2134	2173	2.13e0	SMART
LINK	2204	2298	2.08e-29	SMART
FAS1	2363	2455	3.19e-12	SMART
transmembrane domain	2467	2489	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218408

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933408J17Rik	G	A	10: 93,589,588		probably benign	Het
Actn1	A	T	12: 80,192,389	H247Q	probably damaging	Het
Adgre1	T	C	17: 57,410,956	C323R	probably damaging	Het
Adgrf2	T	A	17: 42,710,407	I509F	probably damaging	Het
Aknad1	A	T	3: 108,756,468	T331S	probably damaging	Het
Aldh1a3	T	C	7: 66,422,299	D39G	probably benign	Het
Alms1	C	A	6: 85,667,963		probably benign	Het
Ankhd1	T	G	18: 36,578,543		probably null	Het
Arfgef2	T	C	2: 166,881,244	S1535P	probably benign	Het
BC027072	C	T	17: 71,751,647	S345N	probably damaging	Het
Bicc1	T	C	10: 70,930,644	E916G	probably damaging	Het
Birc2	A	T	9: 7,821,179	D381E	possibly damaging	Het
Btbd11	T	A	10: 85,651,611	V981D	probably damaging	Het
Carnmt1	A	G	19: 18,693,711	I316V	probably benign	Het
Chd6	T	A	2: 161,029,876	Y213F	possibly damaging	Het
Coq7	A	T	7: 118,510,148	W226R	unknown	Het
Cyp2d9	G	A	15: 82,454,518		probably null	Het
Ddx42	T	A	11: 106,245,329	N635K	probably damaging	Het
Dmtf1	T	C	5: 9,129,323	T292A	possibly damaging	Het
Dnajb8	T	C	6: 88,222,875	V131A	probably benign	Het
Dock6	T	C	9: 21,816,333	E1367G	possibly damaging	Het
Dvl1	T	A	4: 155,855,543	Y377*	probably null	Het
Eif4g3	T	A	4: 138,097,318	F278Y	probably benign	Het
Fancg	A	T	4: 43,008,787	L150H	probably damaging	Het
Fastkd5	T	C	2: 130,616,194	T159A	possibly damaging	Het
Fkrp	G	T	7: 16,810,952	Y328*	probably null	Het
Fmo3	A	T	1: 162,958,305	V372D	probably damaging	Het
Gm10639	T	G	9: 78,304,439	L161R	probably damaging	Het
Gm12184	A	G	11: 48,826,123	I76T	probably damaging	Het
Gm5065	A	T	7: 5,359,834	I155F	probably damaging	Het
Gtf2h4	C	A	17: 35,670,909	G143W	probably damaging	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hmcn1	A	T	1: 150,773,820	Y638*	probably null	Het
Ighv11-2	T	A	12: 114,048,292	Q101L	probably damaging	Het
Lipf	G	T	19: 33,965,525	V78L	probably damaging	Het
Magi3	T	C	3: 104,015,765	E1212G	probably benign	Het
Mfap5	T	C	6: 122,525,989	S75P	probably damaging	Het
Mn1	C	A	5: 111,418,552	H129Q	possibly damaging	Het
Morc3	A	G	16: 93,862,539		probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Myo5c	A	G	9: 75,250,436	I224V	probably damaging	Het
Nupl1	T	C	14: 60,223,359	T486A	probably benign	Het
Olfr1026	A	G	2: 85,923,607	Y113C	probably damaging	Het
Olfr910	T	A	9: 38,538,985	V30D	probably damaging	Het
Parp14	A	T	16: 35,858,203	L465Q	possibly damaging	Het
Plcd3	A	T	11: 103,080,400	I110N	possibly damaging	Het
Prx	A	G	7: 27,518,243	E862G	probably benign	Het
Rad50	G	A	11: 53,707,185		probably benign	Het
Rbm15	A	G	3: 107,330,833	S750P	probably benign	Het
Reln	C	A	5: 22,344,369	A14S	unknown	Het
Rph3a	T	C	5: 120,954,422	Y372C	probably damaging	Het
Serpine2	T	A	1: 79,799,539	H187L	possibly damaging	Het
Slc11a2	T	C	15: 100,401,323	D122G	probably damaging	Het
Slc25a32	A	T	15: 39,096,055	V289E	probably damaging	Het
Slc25a46	A	T	18: 31,602,761	S142T	probably benign	Het
Srm	A	G	4: 148,591,504		probably null	Het
Srsf5	A	G	12: 80,949,096	D123G	probably damaging	Het
Stab1	A	T	14: 31,154,872	C832S	probably damaging	Het
Suds3	T	C	5: 117,094,953	N282S	probably damaging	Het
Taar9	A	T	10: 24,109,254	V94E	probably damaging	Het
Taf2	C	A	15: 55,052,247	A428S	probably benign	Het
Tbk1	G	T	10: 121,557,259	T462K	probably benign	Het
Tcaf2	T	G	6: 42,629,431	I530L	possibly damaging	Het
Tigd4	A	G	3: 84,593,914	Y46C	probably damaging	Het
Topors	G	T	4: 40,261,714	Y523*	probably null	Het
Tpte	T	C	8: 22,333,160		probably benign	Het
Trpv5	T	A	6: 41,674,350	Q254L	probably damaging	Het
Trpv6	G	A	6: 41,624,616	Q457*	probably null	Het
Ush2a	A	T	1: 188,267,107	M205L	probably benign	Het
Vmn1r90	A	T	7: 14,561,718	Y152N	probably damaging	Het
Vmn2r124	T	A	17: 18,074,018	V789D	probably damaging	Het
Vmn2r99	T	C	17: 19,378,708	I218T	probably damaging	Het
Vstm2b	T	C	7: 40,902,875	V248A	probably benign	Het
Wnk2	T	C	13: 49,071,029	K1019E	probably damaging	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp229	T	A	17: 21,745,587	F266Y	possibly damaging	Het
Zfp616	T	A	11: 74,084,268	C454*	probably null	Het

Other mutations in Stab2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Stab2	APN	10	86869206	splice site	probably null
IGL00809:Stab2	APN	10	86848174	splice site	probably benign
IGL00911:Stab2	APN	10	86969753	missense	probably damaging	1.00
IGL01347:Stab2	APN	10	86901703	splice site	probably null
IGL01411:Stab2	APN	10	86980008	splice site	probably benign
IGL01503:Stab2	APN	10	86940613	splice site	probably benign
IGL01599:Stab2	APN	10	86922895	missense	probably damaging	1.00
IGL01635:Stab2	APN	10	86981128	missense	probably benign	0.04
IGL01640:Stab2	APN	10	86954171	missense	probably benign	0.09
IGL01671:Stab2	APN	10	86969277	missense	possibly damaging	0.80
IGL02023:Stab2	APN	10	86871831	missense	possibly damaging	0.67
IGL02075:Stab2	APN	10	86967650	missense	possibly damaging	0.71
IGL02174:Stab2	APN	10	86859742	splice site	probably null
IGL02600:Stab2	APN	10	86954259	missense	probably damaging	1.00
IGL02666:Stab2	APN	10	86850902	missense	possibly damaging	0.67
IGL02668:Stab2	APN	10	86846163	splice site	probably benign
IGL02709:Stab2	APN	10	86846165	splice site	probably benign
IGL02728:Stab2	APN	10	86856556	missense	possibly damaging	0.95
IGL02803:Stab2	APN	10	86950269	splice site	probably benign
IGL02938:Stab2	APN	10	86871921	missense	possibly damaging	0.77
IGL03033:Stab2	APN	10	86996803	critical splice donor site	probably null
IGL03238:Stab2	APN	10	86855121	missense	probably damaging	1.00
IGL03402:Stab2	APN	10	86969301	missense	probably benign	0.03
prospector	UTSW	10	86901567	splice site	probably null
songbird	UTSW	10	86858152	missense	probably damaging	1.00
3-1:Stab2	UTSW	10	86869177	missense	probably damaging	0.96
F6893:Stab2	UTSW	10	86855171	missense	probably damaging	1.00
K7371:Stab2	UTSW	10	86943289	critical splice donor site	probably null
PIT4142001:Stab2	UTSW	10	86867175	missense	possibly damaging	0.94
PIT4362001:Stab2	UTSW	10	86861435	nonsense	probably null
R0015:Stab2	UTSW	10	86843617	missense	probably benign
R0254:Stab2	UTSW	10	86897960	missense	probably benign
R0310:Stab2	UTSW	10	86967613	splice site	probably benign
R0333:Stab2	UTSW	10	86841627	missense	probably benign
R0391:Stab2	UTSW	10	86947144	missense	probably benign	0.27
R0400:Stab2	UTSW	10	86872610	missense	probably damaging	1.00
R0433:Stab2	UTSW	10	86843491	splice site	probably benign
R0440:Stab2	UTSW	10	86949928	missense	probably benign	0.23
R0743:Stab2	UTSW	10	86887895	missense	probably damaging	1.00
R0847:Stab2	UTSW	10	86969871	missense	probably benign	0.00
R0883:Stab2	UTSW	10	86924450	splice site	probably benign
R1078:Stab2	UTSW	10	86907133	splice site	probably null
R1118:Stab2	UTSW	10	86885718	splice site	probably null
R1119:Stab2	UTSW	10	86859755	missense	possibly damaging	0.51
R1179:Stab2	UTSW	10	86950301	missense	probably damaging	0.98
R1440:Stab2	UTSW	10	86861367	splice site	probably null
R1550:Stab2	UTSW	10	86878926	missense	probably benign	0.01
R1616:Stab2	UTSW	10	86885718	splice site	probably null
R1728:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1768:Stab2	UTSW	10	87003008	missense	probably damaging	1.00
R1772:Stab2	UTSW	10	86954234	missense	probably benign	0.06
R1776:Stab2	UTSW	10	86957816	missense	possibly damaging	0.92
R1784:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1892:Stab2	UTSW	10	86938049	missense	probably damaging	0.99
R1957:Stab2	UTSW	10	86861470	missense	probably benign	0.13
R1972:Stab2	UTSW	10	86960316	missense	probably damaging	0.99
R1975:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1976:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1996:Stab2	UTSW	10	87003031	missense	probably damaging	1.00
R2085:Stab2	UTSW	10	86954159	missense	probably damaging	1.00
R2149:Stab2	UTSW	10	86865040	nonsense	probably null
R2169:Stab2	UTSW	10	86887862	missense	probably damaging	1.00
R2201:Stab2	UTSW	10	86940639	missense	probably benign	0.22
R2296:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2297:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2298:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2326:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2434:Stab2	UTSW	10	86969319	missense	possibly damaging	0.78
R2696:Stab2	UTSW	10	86861499	missense	probably benign	0.45
R2883:Stab2	UTSW	10	86967686	missense	possibly damaging	0.92
R2923:Stab2	UTSW	10	86861461	missense	probably damaging	1.00
R3711:Stab2	UTSW	10	86866708	missense	probably damaging	1.00
R3787:Stab2	UTSW	10	86969277	missense	possibly damaging	0.50
R3834:Stab2	UTSW	10	86949912	missense	possibly damaging	0.87
R3970:Stab2	UTSW	10	86878886	missense	probably damaging	0.97
R3979:Stab2	UTSW	10	86863456	missense	possibly damaging	0.56
R4003:Stab2	UTSW	10	86858124	missense	probably damaging	1.00
R4088:Stab2	UTSW	10	86922185	missense	probably damaging	1.00
R4151:Stab2	UTSW	10	87002983	missense	probably benign	0.12
R4190:Stab2	UTSW	10	86878944	missense	probably damaging	0.98
R4556:Stab2	UTSW	10	86967679	missense	possibly damaging	0.95
R4773:Stab2	UTSW	10	86907371	nonsense	probably null
R4825:Stab2	UTSW	10	86947147	missense	probably benign	0.08
R4865:Stab2	UTSW	10	86843500	splice site	probably null
R4871:Stab2	UTSW	10	86942235	missense	probably damaging	0.99
R4943:Stab2	UTSW	10	86954162	missense	probably damaging	0.99
R4981:Stab2	UTSW	10	86960223	missense	probably benign
R4994:Stab2	UTSW	10	86949907	missense	probably benign
R4999:Stab2	UTSW	10	86937909	missense	probably damaging	0.97
R5061:Stab2	UTSW	10	86907385	missense	probably damaging	1.00
R5072:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5073:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5074:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5134:Stab2	UTSW	10	86871810	splice site	probably null
R5213:Stab2	UTSW	10	86907197	missense	probably damaging	0.99
R5508:Stab2	UTSW	10	86960279	missense	probably benign	0.01
R5530:Stab2	UTSW	10	86947162	missense	probably benign	0.04
R5540:Stab2	UTSW	10	86848125	missense	probably benign	0.30
R5839:Stab2	UTSW	10	86872691	missense	probably damaging	0.97
R5949:Stab2	UTSW	10	86969849	missense	possibly damaging	0.87
R6015:Stab2	UTSW	10	86938042	missense	probably damaging	0.99
R6019:Stab2	UTSW	10	87003022	missense	probably benign	0.00
R6116:Stab2	UTSW	10	86907190	missense	probably damaging	1.00
R6131:Stab2	UTSW	10	86883778	splice site	probably null
R6209:Stab2	UTSW	10	86923003	missense	possibly damaging	0.94
R6243:Stab2	UTSW	10	86907161	missense	probably damaging	1.00
R6433:Stab2	UTSW	10	86901567	splice site	probably null
R6787:Stab2	UTSW	10	86919084	missense	probably benign	0.07
R6841:Stab2	UTSW	10	86942190	missense	probably damaging	1.00
R6873:Stab2	UTSW	10	86861366	critical splice donor site	probably null
R7025:Stab2	UTSW	10	86850837	missense	probably damaging	1.00
R7043:Stab2	UTSW	10	86870246	missense	probably damaging	0.99
R7047:Stab2	UTSW	10	86858152	missense	probably damaging	1.00
R7107:Stab2	UTSW	10	86905592	missense	possibly damaging	0.96
R7214:Stab2	UTSW	10	86899841	missense	probably damaging	0.99
R7271:Stab2	UTSW	10	87003108	splice site	probably null
R7291:Stab2	UTSW	10	86946220	missense	probably damaging	0.96
R7336:Stab2	UTSW	10	86969185	nonsense	probably null
R7432:Stab2	UTSW	10	86885683	missense	probably damaging	0.99
R7580:Stab2	UTSW	10	86869164	missense	probably benign	0.00
R7622:Stab2	UTSW	10	86873902	missense	possibly damaging	0.65
R7629:Stab2	UTSW	10	86883782	critical splice donor site	probably null
R7658:Stab2	UTSW	10	86981135	missense	probably benign	0.12
R7798:Stab2	UTSW	10	86957912	missense	probably damaging	0.98
R7835:Stab2	UTSW	10	86872619	missense	probably benign	0.06
R7845:Stab2	UTSW	10	86996894	missense	probably benign	0.09
R7863:Stab2	UTSW	10	86972881	missense	probably benign	0.30
R7885:Stab2	UTSW	10	86878912	missense	probably benign	0.03
R7904:Stab2	UTSW	10	86954192	nonsense	probably null
R7947:Stab2	UTSW	10	86846033	missense	probably benign	0.31
R7963:Stab2	UTSW	10	86848023	critical splice donor site	probably null
R8014:Stab2	UTSW	10	86850903	missense	possibly damaging	0.78
R8021:Stab2	UTSW	10	86905539	missense	possibly damaging	0.69
R8024:Stab2	UTSW	10	86846052	missense	probably benign	0.34
R8097:Stab2	UTSW	10	86869095	missense	possibly damaging	0.86
R8281:Stab2	UTSW	10	86873864	missense	probably damaging	0.98
R8462:Stab2	UTSW	10	86967734	missense	possibly damaging	0.79
R8670:Stab2	UTSW	10	86940723	missense	probably damaging	1.00
R8692:Stab2	UTSW	10	86972930	missense	probably damaging	0.99
R8744:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8745:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8782:Stab2	UTSW	10	86899821	missense	probably benign	0.00
R8875:Stab2	UTSW	10	86996864	missense	probably damaging	1.00
R8978:Stab2	UTSW	10	86949918	missense	possibly damaging	0.64
R9141:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9248:Stab2	UTSW	10	86891617	missense	probably damaging	0.98
R9326:Stab2	UTSW	10	86955146	missense	probably damaging	1.00
R9426:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9568:Stab2	UTSW	10	86863556	missense	probably damaging	1.00
R9627:Stab2	UTSW	10	86957840	missense	probably damaging	0.98
R9635:Stab2	UTSW	10	86850787	nonsense	probably null
R9648:Stab2	UTSW	10	86856697	frame shift	probably null
R9649:Stab2	UTSW	10	86856697	frame shift	probably null
R9650:Stab2	UTSW	10	86856697	frame shift	probably null
R9726:Stab2	UTSW	10	86954231	missense	probably benign	0.00
R9756:Stab2	UTSW	10	86967689	missense	possibly damaging	0.50
R9786:Stab2	UTSW	10	86922133	missense	probably benign	0.03
RF061:Stab2	UTSW	10	86866758	critical splice acceptor site	probably benign
X0023:Stab2	UTSW	10	86922198	critical splice acceptor site	probably null
X0025:Stab2	UTSW	10	86887816	missense	probably damaging	1.00
Z1176:Stab2	UTSW	10	86949914	missense	probably damaging	0.99
Z1177:Stab2	UTSW	10	86896596	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCAAAGCTGTCACTGTCTTC -3'
(R):5'- CTTCCTGCACAAAGCTAATCTGG -3'

Sequencing Primer
(F):5'- TCCACTATTCTGAAGCAGCATGG -3'
(R):5'- AGCTAATCTGGCCCAGGCATTC -3'

Posted On

2014-12-04