Incidental Mutation 'R7622:Stab2'
ID 589206
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Name stabilin 2
Synonyms STAB-2, FEEL-2
MMRRC Submission 045717-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7622 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 86841198-87008025 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86873902 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1626 (H1626Q)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
AlphaFold Q8R4U0
Predicted Effect possibly damaging
Transcript: ENSMUST00000035288
AA Change: H1626Q

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: H1626Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Predicted Effect
Meta Mutation Damage Score 0.2643 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 G A 5: 129,139,624 (GRCm38) D384N probably benign Het
Aqp8 T C 7: 123,466,660 (GRCm38) F226S possibly damaging Het
Arl6ip6 A G 2: 53,217,327 (GRCm38) Y207C probably damaging Het
Bltp1 C A 3: 36,948,413 (GRCm38) C1502* probably null Het
Cbfa2t2 A G 2: 154,500,445 (GRCm38) E27G possibly damaging Het
Cdc42bpb T G 12: 111,294,772 (GRCm38) E201A unknown Het
Cfap54 A C 10: 92,956,944 (GRCm38) V1769G unknown Het
Dmxl2 C T 9: 54,472,218 (GRCm38) G7S probably damaging Het
Dnah6 G T 6: 73,124,759 (GRCm38) F1927L possibly damaging Het
Dnajc6 A G 4: 101,640,491 (GRCm38) E942G probably damaging Het
Fam170a A G 18: 50,282,902 (GRCm38) R324G probably benign Het
Gapdhs G A 7: 30,739,331 (GRCm38) T9I unknown Het
Gm10320 T A 13: 98,489,724 (GRCm38) R51* probably null Het
Gm19410 A T 8: 35,810,347 (GRCm38) T1776S possibly damaging Het
Gm4846 A T 1: 166,495,872 (GRCm38) M94K possibly damaging Het
Ighv2-5 G A 12: 113,685,738 (GRCm38) Q32* probably null Het
Klc2 T C 19: 5,111,632 (GRCm38) E310G probably damaging Het
Krt75 A G 15: 101,570,272 (GRCm38) M309T probably damaging Het
Lrp11 G A 10: 7,590,172 (GRCm38) G41R unknown Het
Lrrc52 G T 1: 167,466,095 (GRCm38) P207Q probably benign Het
Lrrc52 G T 1: 167,466,096 (GRCm38) P207T probably benign Het
Lrrk2 A T 15: 91,812,323 (GRCm38) D2438V probably damaging Het
Mycbp C T 4: 123,905,301 (GRCm38) T28M probably damaging Het
Myh14 A G 7: 44,632,422 (GRCm38) V804A probably benign Het
Myo16 A G 8: 10,376,238 (GRCm38) I332V unknown Het
Ncor1 G T 11: 62,317,968 (GRCm38) Q1359K probably benign Het
Olfr548-ps1 A G 7: 102,542,623 (GRCm38) H229R probably benign Het
Oog3 T C 4: 144,158,319 (GRCm38) D349G probably benign Het
Or12e1 A T 2: 87,192,250 (GRCm38) I188L probably benign Het
Or1j21 A G 2: 36,793,931 (GRCm38) K232E probably benign Het
Or8k53 A G 2: 86,347,662 (GRCm38) Y35H possibly damaging Het
Pate4 A G 9: 35,608,299 (GRCm38) S32P possibly damaging Het
Pcdhb7 A C 18: 37,342,461 (GRCm38) S217R probably benign Het
Pde1c G A 6: 56,126,925 (GRCm38) R580C probably damaging Het
Pi4ka C A 16: 17,293,977 (GRCm38) A1545S Het
Pign G T 1: 105,648,117 (GRCm38) T266K possibly damaging Het
Pitpnm2 A G 5: 124,122,027 (GRCm38) I1134T probably benign Het
Ppfia2 G A 10: 106,830,659 (GRCm38) V409I possibly damaging Het
Prr7 A G 13: 55,472,796 (GRCm38) T206A probably benign Het
Rnf13 A T 3: 57,820,534 (GRCm38) R212* probably null Het
Rwdd2b T C 16: 87,434,612 (GRCm38) N218S probably benign Het
Serpina3m A G 12: 104,389,575 (GRCm38) D167G possibly damaging Het
Slit2 A T 5: 47,985,205 (GRCm38) N56Y probably damaging Het
Sprr3 G T 3: 92,457,285 (GRCm38) T84K probably damaging Het
Tex2 C A 11: 106,546,895 (GRCm38) D650Y unknown Het
Tmprss6 A G 15: 78,446,726 (GRCm38) S436P probably benign Het
Uba2 A C 7: 34,165,435 (GRCm38) F63L probably damaging Het
Ubxn2b C T 4: 6,214,692 (GRCm38) S242L probably damaging Het
Vmn1r86 T G 7: 13,102,758 (GRCm38) I64L probably benign Het
Vmn2r67 A T 7: 85,136,454 (GRCm38) V781E probably damaging Het
Vmn2r80 T A 10: 79,194,263 (GRCm38) F641Y probably damaging Het
Wdfy4 A T 14: 33,078,274 (GRCm38) I1965K Het
Wdr25 G A 12: 108,992,893 (GRCm38) G344S possibly damaging Het
Wdr90 G T 17: 25,854,109 (GRCm38) F837L probably benign Het
Xpo4 A G 14: 57,597,011 (GRCm38) V704A possibly damaging Het
Zc3h12d A G 10: 7,867,269 (GRCm38) K268E probably damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86,869,206 (GRCm38) splice site probably null
IGL00809:Stab2 APN 10 86,848,174 (GRCm38) splice site probably benign
IGL00911:Stab2 APN 10 86,969,753 (GRCm38) missense probably damaging 1.00
IGL01347:Stab2 APN 10 86,901,703 (GRCm38) splice site probably null
IGL01411:Stab2 APN 10 86,980,008 (GRCm38) splice site probably benign
IGL01503:Stab2 APN 10 86,940,613 (GRCm38) splice site probably benign
IGL01599:Stab2 APN 10 86,922,895 (GRCm38) missense probably damaging 1.00
IGL01635:Stab2 APN 10 86,981,128 (GRCm38) missense probably benign 0.04
IGL01640:Stab2 APN 10 86,954,171 (GRCm38) missense probably benign 0.09
IGL01671:Stab2 APN 10 86,969,277 (GRCm38) missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86,871,831 (GRCm38) missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86,967,650 (GRCm38) missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86,859,742 (GRCm38) splice site probably null
IGL02600:Stab2 APN 10 86,954,259 (GRCm38) missense probably damaging 1.00
IGL02666:Stab2 APN 10 86,850,902 (GRCm38) missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86,846,163 (GRCm38) splice site probably benign
IGL02709:Stab2 APN 10 86,846,165 (GRCm38) splice site probably benign
IGL02728:Stab2 APN 10 86,856,556 (GRCm38) missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86,950,269 (GRCm38) splice site probably benign
IGL02938:Stab2 APN 10 86,871,921 (GRCm38) missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86,996,803 (GRCm38) critical splice donor site probably null
IGL03238:Stab2 APN 10 86,855,121 (GRCm38) missense probably damaging 1.00
IGL03402:Stab2 APN 10 86,969,301 (GRCm38) missense probably benign 0.03
prospector UTSW 10 86,901,567 (GRCm38) splice site probably null
songbird UTSW 10 86,858,152 (GRCm38) missense probably damaging 1.00
3-1:Stab2 UTSW 10 86,869,177 (GRCm38) missense probably damaging 0.96
F6893:Stab2 UTSW 10 86,855,171 (GRCm38) missense probably damaging 1.00
K7371:Stab2 UTSW 10 86,943,289 (GRCm38) critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86,867,175 (GRCm38) missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86,861,435 (GRCm38) nonsense probably null
R0015:Stab2 UTSW 10 86,843,617 (GRCm38) missense probably benign
R0254:Stab2 UTSW 10 86,897,960 (GRCm38) missense probably benign
R0310:Stab2 UTSW 10 86,967,613 (GRCm38) splice site probably benign
R0333:Stab2 UTSW 10 86,841,627 (GRCm38) missense probably benign
R0391:Stab2 UTSW 10 86,947,144 (GRCm38) missense probably benign 0.27
R0400:Stab2 UTSW 10 86,872,610 (GRCm38) missense probably damaging 1.00
R0433:Stab2 UTSW 10 86,843,491 (GRCm38) splice site probably benign
R0440:Stab2 UTSW 10 86,949,928 (GRCm38) missense probably benign 0.23
R0743:Stab2 UTSW 10 86,887,895 (GRCm38) missense probably damaging 1.00
R0847:Stab2 UTSW 10 86,969,871 (GRCm38) missense probably benign 0.00
R0883:Stab2 UTSW 10 86,924,450 (GRCm38) splice site probably benign
R1078:Stab2 UTSW 10 86,907,133 (GRCm38) splice site probably null
R1118:Stab2 UTSW 10 86,885,718 (GRCm38) splice site probably null
R1119:Stab2 UTSW 10 86,859,755 (GRCm38) missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86,950,301 (GRCm38) missense probably damaging 0.98
R1440:Stab2 UTSW 10 86,861,367 (GRCm38) splice site probably null
R1550:Stab2 UTSW 10 86,878,926 (GRCm38) missense probably benign 0.01
R1616:Stab2 UTSW 10 86,885,718 (GRCm38) splice site probably null
R1728:Stab2 UTSW 10 86,938,039 (GRCm38) missense probably benign 0.41
R1768:Stab2 UTSW 10 87,003,008 (GRCm38) missense probably damaging 1.00
R1772:Stab2 UTSW 10 86,954,234 (GRCm38) missense probably benign 0.06
R1776:Stab2 UTSW 10 86,957,816 (GRCm38) missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86,938,039 (GRCm38) missense probably benign 0.41
R1892:Stab2 UTSW 10 86,938,049 (GRCm38) missense probably damaging 0.99
R1957:Stab2 UTSW 10 86,861,470 (GRCm38) missense probably benign 0.13
R1972:Stab2 UTSW 10 86,960,316 (GRCm38) missense probably damaging 0.99
R1975:Stab2 UTSW 10 86,896,496 (GRCm38) critical splice donor site probably null
R1976:Stab2 UTSW 10 86,896,496 (GRCm38) critical splice donor site probably null
R1996:Stab2 UTSW 10 87,003,031 (GRCm38) missense probably damaging 1.00
R2085:Stab2 UTSW 10 86,954,159 (GRCm38) missense probably damaging 1.00
R2149:Stab2 UTSW 10 86,865,040 (GRCm38) nonsense probably null
R2169:Stab2 UTSW 10 86,887,862 (GRCm38) missense probably damaging 1.00
R2201:Stab2 UTSW 10 86,940,639 (GRCm38) missense probably benign 0.22
R2296:Stab2 UTSW 10 86,954,474 (GRCm38) critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86,954,474 (GRCm38) critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86,954,474 (GRCm38) critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86,954,474 (GRCm38) critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86,969,319 (GRCm38) missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86,934,840 (GRCm38) splice site probably benign
R2696:Stab2 UTSW 10 86,861,499 (GRCm38) missense probably benign 0.45
R2883:Stab2 UTSW 10 86,967,686 (GRCm38) missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86,861,461 (GRCm38) missense probably damaging 1.00
R3711:Stab2 UTSW 10 86,866,708 (GRCm38) missense probably damaging 1.00
R3787:Stab2 UTSW 10 86,969,277 (GRCm38) missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86,949,912 (GRCm38) missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86,878,886 (GRCm38) missense probably damaging 0.97
R3979:Stab2 UTSW 10 86,863,456 (GRCm38) missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86,858,124 (GRCm38) missense probably damaging 1.00
R4088:Stab2 UTSW 10 86,922,185 (GRCm38) missense probably damaging 1.00
R4151:Stab2 UTSW 10 87,002,983 (GRCm38) missense probably benign 0.12
R4190:Stab2 UTSW 10 86,878,944 (GRCm38) missense probably damaging 0.98
R4556:Stab2 UTSW 10 86,967,679 (GRCm38) missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86,907,371 (GRCm38) nonsense probably null
R4825:Stab2 UTSW 10 86,947,147 (GRCm38) missense probably benign 0.08
R4865:Stab2 UTSW 10 86,843,500 (GRCm38) splice site probably null
R4871:Stab2 UTSW 10 86,942,235 (GRCm38) missense probably damaging 0.99
R4943:Stab2 UTSW 10 86,954,162 (GRCm38) missense probably damaging 0.99
R4981:Stab2 UTSW 10 86,960,223 (GRCm38) missense probably benign
R4994:Stab2 UTSW 10 86,949,907 (GRCm38) missense probably benign
R4999:Stab2 UTSW 10 86,937,909 (GRCm38) missense probably damaging 0.97
R5061:Stab2 UTSW 10 86,907,385 (GRCm38) missense probably damaging 1.00
R5072:Stab2 UTSW 10 86,863,558 (GRCm38) missense probably benign 0.23
R5073:Stab2 UTSW 10 86,863,558 (GRCm38) missense probably benign 0.23
R5074:Stab2 UTSW 10 86,863,558 (GRCm38) missense probably benign 0.23
R5134:Stab2 UTSW 10 86,871,810 (GRCm38) splice site probably null
R5213:Stab2 UTSW 10 86,907,197 (GRCm38) missense probably damaging 0.99
R5508:Stab2 UTSW 10 86,960,279 (GRCm38) missense probably benign 0.01
R5530:Stab2 UTSW 10 86,947,162 (GRCm38) missense probably benign 0.04
R5540:Stab2 UTSW 10 86,848,125 (GRCm38) missense probably benign 0.30
R5839:Stab2 UTSW 10 86,872,691 (GRCm38) missense probably damaging 0.97
R5949:Stab2 UTSW 10 86,969,849 (GRCm38) missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86,938,042 (GRCm38) missense probably damaging 0.99
R6019:Stab2 UTSW 10 87,003,022 (GRCm38) missense probably benign 0.00
R6116:Stab2 UTSW 10 86,907,190 (GRCm38) missense probably damaging 1.00
R6131:Stab2 UTSW 10 86,883,778 (GRCm38) splice site probably null
R6209:Stab2 UTSW 10 86,923,003 (GRCm38) missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86,907,161 (GRCm38) missense probably damaging 1.00
R6433:Stab2 UTSW 10 86,901,567 (GRCm38) splice site probably null
R6787:Stab2 UTSW 10 86,919,084 (GRCm38) missense probably benign 0.07
R6841:Stab2 UTSW 10 86,942,190 (GRCm38) missense probably damaging 1.00
R6873:Stab2 UTSW 10 86,861,366 (GRCm38) critical splice donor site probably null
R7025:Stab2 UTSW 10 86,850,837 (GRCm38) missense probably damaging 1.00
R7043:Stab2 UTSW 10 86,870,246 (GRCm38) missense probably damaging 0.99
R7047:Stab2 UTSW 10 86,858,152 (GRCm38) missense probably damaging 1.00
R7107:Stab2 UTSW 10 86,905,592 (GRCm38) missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86,899,841 (GRCm38) missense probably damaging 0.99
R7271:Stab2 UTSW 10 87,003,108 (GRCm38) splice site probably null
R7291:Stab2 UTSW 10 86,946,220 (GRCm38) missense probably damaging 0.96
R7336:Stab2 UTSW 10 86,969,185 (GRCm38) nonsense probably null
R7432:Stab2 UTSW 10 86,885,683 (GRCm38) missense probably damaging 0.99
R7580:Stab2 UTSW 10 86,869,164 (GRCm38) missense probably benign 0.00
R7629:Stab2 UTSW 10 86,883,782 (GRCm38) critical splice donor site probably null
R7658:Stab2 UTSW 10 86,981,135 (GRCm38) missense probably benign 0.12
R7798:Stab2 UTSW 10 86,957,912 (GRCm38) missense probably damaging 0.98
R7835:Stab2 UTSW 10 86,872,619 (GRCm38) missense probably benign 0.06
R7845:Stab2 UTSW 10 86,996,894 (GRCm38) missense probably benign 0.09
R7863:Stab2 UTSW 10 86,972,881 (GRCm38) missense probably benign 0.30
R7885:Stab2 UTSW 10 86,878,912 (GRCm38) missense probably benign 0.03
R7904:Stab2 UTSW 10 86,954,192 (GRCm38) nonsense probably null
R7947:Stab2 UTSW 10 86,846,033 (GRCm38) missense probably benign 0.31
R7963:Stab2 UTSW 10 86,848,023 (GRCm38) critical splice donor site probably null
R8014:Stab2 UTSW 10 86,850,903 (GRCm38) missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86,905,539 (GRCm38) missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86,846,052 (GRCm38) missense probably benign 0.34
R8097:Stab2 UTSW 10 86,869,095 (GRCm38) missense possibly damaging 0.86
R8281:Stab2 UTSW 10 86,873,864 (GRCm38) missense probably damaging 0.98
R8462:Stab2 UTSW 10 86,967,734 (GRCm38) missense possibly damaging 0.79
R8670:Stab2 UTSW 10 86,940,723 (GRCm38) missense probably damaging 1.00
R8692:Stab2 UTSW 10 86,972,930 (GRCm38) missense probably damaging 0.99
R8744:Stab2 UTSW 10 86,969,349 (GRCm38) missense probably benign 0.32
R8745:Stab2 UTSW 10 86,969,349 (GRCm38) missense probably benign 0.32
R8782:Stab2 UTSW 10 86,899,821 (GRCm38) missense probably benign 0.00
R8875:Stab2 UTSW 10 86,996,864 (GRCm38) missense probably damaging 1.00
R8978:Stab2 UTSW 10 86,949,918 (GRCm38) missense possibly damaging 0.64
R9141:Stab2 UTSW 10 86,869,047 (GRCm38) missense probably damaging 1.00
R9248:Stab2 UTSW 10 86,891,617 (GRCm38) missense probably damaging 0.98
R9326:Stab2 UTSW 10 86,955,146 (GRCm38) missense probably damaging 1.00
R9426:Stab2 UTSW 10 86,869,047 (GRCm38) missense probably damaging 1.00
R9568:Stab2 UTSW 10 86,863,556 (GRCm38) missense probably damaging 1.00
R9627:Stab2 UTSW 10 86,957,840 (GRCm38) missense probably damaging 0.98
R9635:Stab2 UTSW 10 86,850,787 (GRCm38) nonsense probably null
R9648:Stab2 UTSW 10 86,856,697 (GRCm38) frame shift probably null
R9649:Stab2 UTSW 10 86,856,697 (GRCm38) frame shift probably null
R9650:Stab2 UTSW 10 86,856,697 (GRCm38) frame shift probably null
R9726:Stab2 UTSW 10 86,954,231 (GRCm38) missense probably benign 0.00
R9756:Stab2 UTSW 10 86,967,689 (GRCm38) missense possibly damaging 0.50
R9786:Stab2 UTSW 10 86,922,133 (GRCm38) missense probably benign 0.03
RF061:Stab2 UTSW 10 86,866,758 (GRCm38) critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86,922,198 (GRCm38) critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86,887,816 (GRCm38) missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86,949,914 (GRCm38) missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86,896,596 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCAGCCCCTTCTATTGC -3'
(R):5'- CCAAGTCATCTTTGATGCGGG -3'

Sequencing Primer
(F):5'- AGCCCCTTCTATTGCTGGTCAG -3'
(R):5'- GGAAGAGCTGTTATCATCTTGATAC -3'
Posted On 2019-10-24