Mutagenetix > Incidental Mutation

Incidental Mutation 'R1167:Gga1'

101203

Institutional Source

Beutler Lab

Gene Symbol

Gga1

Ensembl Gene

ENSMUSG00000033128

Gene Name

golgi associated, gamma adaptin ear containing, ARF binding protein 1

Synonyms

4930406E12Rik

MMRRC Submission

039240-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R1167 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78877190-78894585 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 78888170 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 223 (N223K)

Ref Sequence

ENSEMBL: ENSMUSP00000035992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041587] [ENSMUST00000230192]

AlphaFold

Q8R0H9

Predicted Effect

probably damaging
Transcript: ENSMUST00000041587
AA Change: N223K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035992
Gene: ENSMUSG00000033128
AA Change: N223K

Domain	Start	End	E-Value	Type
VHS	10	143	9.89e-45	SMART
Pfam:GAT	222	299	1.4e-27	PFAM
low complexity region	313	340	N/A	INTRINSIC
low complexity region	366	378	N/A	INTRINSIC
low complexity region	419	425	N/A	INTRINSIC
low complexity region	459	470	N/A	INTRINSIC
low complexity region	474	489	N/A	INTRINSIC
Alpha_adaptinC2	503	627	4.21e-37	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183370

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229353

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230192
AA Change: N223K

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230243

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230772

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) protein family. Members of this family are ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele display decreased birth weight, slow postnatal weight gain, hypoglycemia, increased plasma levels of acid hydrolases, and partial neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,579	D315V	probably damaging	Het
4931440F15Rik	C	T	11: 29,823,567	R630H	probably damaging	Het
Acr	T	C	15: 89,573,974	I286T	probably damaging	Het
Adnp	A	G	2: 168,184,500	S292P	probably benign	Het
Apol6	T	A	15: 77,047,108	Y17*	probably null	Het
Arhgap22	A	G	14: 33,343,307		probably null	Het
Bfar	A	G	16: 13,698,894	K202E	possibly damaging	Het
Bmpr2	A	T	1: 59,859,304	S470C	probably damaging	Het
Cep135	A	G	5: 76,624,637	E623G	probably damaging	Het
Clcn3	A	G	8: 60,922,788		probably null	Het
Clptm1	A	T	7: 19,634,211	M523K	probably damaging	Het
Cyp26b1	A	G	6: 84,584,330	W117R	probably damaging	Het
Dnmt3c	T	G	2: 153,711,781		probably null	Het
Dst	A	G	1: 34,223,858	E2212G	probably damaging	Het
Edrf1	A	G	7: 133,644,066	T238A	probably benign	Het
Elmo1	T	C	13: 20,185,455	V10A	probably damaging	Het
Ermp1	A	G	19: 29,628,679	S225P	possibly damaging	Het
Fes	A	T	7: 80,383,109	L296Q	probably damaging	Het
Foxn1	A	T	11: 78,359,066	N544K	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm4884	A	T	7: 41,043,912	Q435L	possibly damaging	Het
Gm8444	T	C	15: 81,843,380		probably benign	Het
Gm8882	G	A	6: 132,361,590	P222S	unknown	Het
Ift140	T	G	17: 25,035,745	S131A	probably benign	Het
Ipo4	A	G	14: 55,635,020	L88P	probably damaging	Het
Itgal	G	A	7: 127,300,939	S123N	probably damaging	Het
Kcnn3	C	T	3: 89,564,952	Q344*	probably null	Het
Lrrc8e	A	T	8: 4,235,337	M521L	probably benign	Het
Myocd	G	T	11: 65,196,377	D113E	possibly damaging	Het
Nek4	G	A	14: 30,974,345	R499H	possibly damaging	Het
Notch3	T	C	17: 32,122,745	D2011G	possibly damaging	Het
Ola1	A	G	2: 73,097,194	V347A	probably damaging	Het
Olfr1037	A	G	2: 86,085,291	V162A	probably benign	Het
Olfr1339	C	A	4: 118,734,632	F34L	possibly damaging	Het
Olfr790	G	A	10: 129,501,150	V89I	probably benign	Het
Oxct2b	A	G	4: 123,117,585	T433A	probably damaging	Het
P2ry14	T	C	3: 59,115,131	R312G	probably damaging	Het
Pbrm1	A	G	14: 31,050,142	N398D	probably damaging	Het
Pdc	T	C	1: 150,333,245	Y160H	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pop4	A	T	7: 38,263,269	D190E	probably benign	Het
R3hdm4	A	G	10: 79,912,073		probably null	Het
Rab1a	C	A	11: 20,223,172	T91K	possibly damaging	Het
Rad9a	A	G	19: 4,197,502	V215A	possibly damaging	Het
Rassf3	A	G	10: 121,416,254	V84A	probably damaging	Het
Rftn2	G	A	1: 55,204,299	T270M	probably damaging	Het
Rho	A	G	6: 115,935,423	T100A	probably damaging	Het
Rnft2	T	C	5: 118,228,882	I264V	possibly damaging	Het
Robo3	A	T	9: 37,423,907	Y567*	probably null	Het
Rpp14	T	A	14: 8,083,705		probably null	Het
Rtkn2	T	C	10: 67,997,620	S98P	probably damaging	Het
Ryr2	A	G	13: 11,660,113	V3376A	possibly damaging	Het
Sbf2	A	T	7: 110,364,549	W1030R	probably damaging	Het
Setbp1	G	A	18: 78,857,236	A1072V	possibly damaging	Het
Slc4a10	A	G	2: 62,228,574	K142E	probably damaging	Het
Slc52a2	A	G	15: 76,539,591	E40G	probably benign	Het
Slc8a2	A	G	7: 16,157,387	N784S	possibly damaging	Het
Spats2l	A	T	1: 57,943,111	Q384L	probably damaging	Het
Steap4	A	C	5: 7,976,520	K161T	probably benign	Het
Taf10	T	C	7: 105,743,231	S188G	probably benign	Het
Tbc1d4	C	T	14: 101,608,019	D148N	probably damaging	Het
Tenm2	T	G	11: 36,864,684	K162N	probably benign	Het
Tmem147	A	G	7: 30,727,796	V146A	probably benign	Het
Tnfsf8	A	G	4: 63,837,086	S100P	possibly damaging	Het
Trim56	T	C	5: 137,112,520	Y714C	probably damaging	Het
Ubxn8	A	G	8: 33,641,901	S13P	probably damaging	Het
Usp49	A	G	17: 47,672,226	D52G	possibly damaging	Het
Vegfc	A	C	8: 54,186,043	Y408S	probably benign	Het
Vmn2r77	A	G	7: 86,801,746	N280S	probably benign	Het
Vmn2r8	T	A	5: 108,803,176	L134F	probably benign	Het
Wdfy3	T	A	5: 101,875,931	I2437F	probably benign	Het
Wwc2	A	T	8: 47,858,779	L783*	probably null	Het
Zer1	C	T	2: 30,108,246	R351H	probably benign	Het
Zfp715	A	T	7: 43,298,437	F700I	possibly damaging	Het
Zfp995	G	A	17: 21,879,979	H425Y	probably damaging	Het

Other mutations in Gga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Gga1	APN	15	78883355	missense	possibly damaging	0.68
IGL01921:Gga1	APN	15	78893795	missense	possibly damaging	0.82
IGL02178:Gga1	APN	15	78892047	missense	probably benign	0.00
IGL02697:Gga1	APN	15	78885346	missense	probably damaging	1.00
IGL02931:Gga1	APN	15	78893322	missense	possibly damaging	0.95
IGL03025:Gga1	APN	15	78888182	missense	probably damaging	1.00
PIT4472001:Gga1	UTSW	15	78893636	missense	probably damaging	1.00
PIT4585001:Gga1	UTSW	15	78893790	missense	probably benign	0.37
R0838:Gga1	UTSW	15	78891918	missense	probably damaging	1.00
R1620:Gga1	UTSW	15	78888470	missense	probably damaging	1.00
R1757:Gga1	UTSW	15	78889030	missense	probably damaging	1.00
R2128:Gga1	UTSW	15	78888448	missense	probably damaging	1.00
R2438:Gga1	UTSW	15	78885298	missense	probably damaging	1.00
R4050:Gga1	UTSW	15	78891491	missense	probably benign	0.01
R4199:Gga1	UTSW	15	78889075	missense	probably damaging	1.00
R4684:Gga1	UTSW	15	78885309	missense	probably damaging	0.99
R5070:Gga1	UTSW	15	78892017	missense	possibly damaging	0.57
R5579:Gga1	UTSW	15	78893188	missense	probably damaging	1.00
R7340:Gga1	UTSW	15	78891451	missense	probably benign	0.00
R7657:Gga1	UTSW	15	78889127	splice site	probably null
R7864:Gga1	UTSW	15	78888244	missense	probably damaging	1.00
R9038:Gga1	UTSW	15	78884121	missense	probably damaging	0.97
R9089:Gga1	UTSW	15	78889752	missense	probably damaging	0.98
R9443:Gga1	UTSW	15	78881047	missense	possibly damaging	0.88
R9504:Gga1	UTSW	15	78883328	missense	probably damaging	1.00
Z1088:Gga1	UTSW	15	78892021	missense	probably damaging	1.00

Predicted Primers

Posted On

2014-01-15