Incidental Mutation 'R1251:Tlr2'
ID151745
Institutional Source Beutler Lab
Gene Symbol Tlr2
Ensembl Gene ENSMUSG00000027995
Gene Nametoll-like receptor 2
SynonymsLy105
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location83836272-83841767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83838269 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 169 (D169G)
Ref Sequence ENSEMBL: ENSMUSP00000029623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029623
AA Change: D169G

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029623
Gene: ENSMUSG00000027995
AA Change: D169G

DomainStartEndE-ValueType
LRR 51 74 1.45e2 SMART
LRR 75 98 2.33e2 SMART
LRR_TYP 99 122 3.69e-4 SMART
low complexity region 268 281 N/A INTRINSIC
LRR 359 384 6.78e1 SMART
LRR 386 409 2.54e2 SMART
LRR 412 435 8.49e1 SMART
LRR_TYP 476 499 3.34e-2 SMART
LRRCT 533 586 5.04e-7 SMART
transmembrane domain 588 610 N/A INTRINSIC
TIR 640 784 5.08e-38 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. This protein is a cell-surface protein that can form heterodimers with other TLR family members to recognize conserved molecules derived from microorganisms known as pathogen-associated molecular patterns (PAMPs). Activation of TLRs by PAMPs leads to an up-regulation of signaling pathways to modulate the host's inflammatory response. This gene is also thought to promote apoptosis in response to bacterial lipoproteins. This gene has been implicated in the pathogenesis of several autoimmune diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice demonstrate abnormal responses to bacterial and viral infections. Mice homozygous for a knock-out allele also exhibit disruption in circadian active and inactive state consolidation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Tlr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01762:Tlr2 APN 3 83836994 missense probably benign
IGL02160:Tlr2 APN 3 83837371 missense possibly damaging 0.47
IGL02405:Tlr2 APN 3 83836674 missense probably damaging 1.00
IGL02940:Tlr2 APN 3 83836474 missense probably benign 0.03
IGL03165:Tlr2 APN 3 83837948 missense probably benign 0.00
languid UTSW 3 83837315 missense probably damaging 1.00
G1patch:Tlr2 UTSW 3 83838296 missense probably benign
PIT4131001:Tlr2 UTSW 3 83838449 missense probably benign 0.34
R1177:Tlr2 UTSW 3 83838734 missense probably benign 0.02
R1346:Tlr2 UTSW 3 83836593 missense probably damaging 0.99
R1553:Tlr2 UTSW 3 83837463 missense probably benign
R1613:Tlr2 UTSW 3 83837353 missense probably damaging 1.00
R1816:Tlr2 UTSW 3 83838209 missense probably damaging 1.00
R2312:Tlr2 UTSW 3 83837540 missense probably damaging 1.00
R3023:Tlr2 UTSW 3 83837871 missense probably benign
R4724:Tlr2 UTSW 3 83838185 missense probably damaging 1.00
R4950:Tlr2 UTSW 3 83837332 missense probably damaging 1.00
R5109:Tlr2 UTSW 3 83837723 missense probably damaging 1.00
R5764:Tlr2 UTSW 3 83838512 missense probably damaging 1.00
R5859:Tlr2 UTSW 3 83836503 missense possibly damaging 0.94
R6169:Tlr2 UTSW 3 83838148 missense probably benign
R6236:Tlr2 UTSW 3 83838131 missense probably benign
R6384:Tlr2 UTSW 3 83836994 missense probably benign
R6564:Tlr2 UTSW 3 83837695 missense probably benign 0.05
R6725:Tlr2 UTSW 3 83838296 missense probably benign
R7032:Tlr2 UTSW 3 83837905 missense probably benign 0.01
R7256:Tlr2 UTSW 3 83837606 missense possibly damaging 0.93
R7571:Tlr2 UTSW 3 83836542 missense probably damaging 1.00
R7970:Tlr2 UTSW 3 83837894 missense probably benign 0.01
R8191:Tlr2 UTSW 3 83836514 missense probably damaging 1.00
R8191:Tlr2 UTSW 3 83836515 missense probably damaging 0.99
R8217:Tlr2 UTSW 3 83838066 missense probably benign 0.17
R8218:Tlr2 UTSW 3 83838239 missense probably damaging 1.00
R8834:Tlr2 UTSW 3 83838713 missense probably benign
Z1177:Tlr2 UTSW 3 83836607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCTACGGGCAGTGGTGAAAAC -3'
(R):5'- TCTCTGGGCAGTCTTGAACATTTGG -3'

Sequencing Primer
(F):5'- GTGAAAACTGGAACCTGGC -3'
(R):5'- CAGTCTTGAACATTTGGATTTGTC -3'
Posted On2014-01-29