Incidental Mutation 'R1251:Olfr513'
ID 151756
Institutional Source Beutler Lab
Gene Symbol Olfr513
Ensembl Gene ENSMUSG00000051200
Gene Name olfactory receptor 513
Synonyms MOR195-1, GA_x6K02T2PBJ9-11084889-11085818
MMRRC Submission 039318-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R1251 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 108750973-108756800 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 108754907 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Cysteine at position 17 (F17C)
Ref Sequence ENSEMBL: ENSMUSP00000149440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055146] [ENSMUST00000214670]
AlphaFold Q8VFZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000055146
AA Change: F17C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050578
Gene: ENSMUSG00000051200
AA Change: F17C

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 2.7e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 304 2.3e-6 PFAM
Pfam:7tm_1 39 289 2.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214670
AA Change: F17C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Olfr513
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Olfr513 APN 7 108755114 missense probably damaging 1.00
IGL03086:Olfr513 APN 7 108755796 utr 3 prime probably benign
FR4340:Olfr513 UTSW 7 108754954 small insertion probably benign
IGL02799:Olfr513 UTSW 7 108755623 missense probably benign
R0218:Olfr513 UTSW 7 108755574 nonsense probably null
R1103:Olfr513 UTSW 7 108754883 missense possibly damaging 0.92
R1450:Olfr513 UTSW 7 108755512 missense probably damaging 1.00
R1582:Olfr513 UTSW 7 108755110 missense probably benign 0.04
R1608:Olfr513 UTSW 7 108755102 missense probably damaging 0.99
R1726:Olfr513 UTSW 7 108755008 missense probably benign 0.00
R1880:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R1881:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R2136:Olfr513 UTSW 7 108755223 missense possibly damaging 0.58
R2216:Olfr513 UTSW 7 108755612 missense probably damaging 1.00
R4006:Olfr513 UTSW 7 108755261 missense probably damaging 1.00
R4603:Olfr513 UTSW 7 108755627 missense probably damaging 1.00
R4881:Olfr513 UTSW 7 108755405 missense probably damaging 1.00
R5132:Olfr513 UTSW 7 108755270 missense probably damaging 1.00
R5426:Olfr513 UTSW 7 108755717 missense possibly damaging 0.94
R5679:Olfr513 UTSW 7 108754996 missense probably damaging 0.97
R5848:Olfr513 UTSW 7 108755574 nonsense probably null
R5911:Olfr513 UTSW 7 108755675 missense probably benign 0.36
R6474:Olfr513 UTSW 7 108755029 missense probably damaging 1.00
R7016:Olfr513 UTSW 7 108755711 missense probably damaging 1.00
R7783:Olfr513 UTSW 7 108755569 missense probably damaging 1.00
R8113:Olfr513 UTSW 7 108755231 missense probably damaging 1.00
R8385:Olfr513 UTSW 7 108755304 nonsense probably null
R9429:Olfr513 UTSW 7 108755205 missense probably damaging 0.98
R9746:Olfr513 UTSW 7 108755432 missense probably benign
Z1088:Olfr513 UTSW 7 108755104 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CAGAATCAGATATGCTGTCTGGCCC -3'
(R):5'- TATCACCAGTTCCTTGCAGACCCG -3'

Sequencing Primer
(F):5'- GTCTGGCCCTAGACTTAAACTGAAG -3'
(R):5'- CCATGTAACGATCATAGGCCATTG -3'
Posted On 2014-01-29