Incidental Mutation 'R1081:Sntg1'
ID152678
Institutional Source Beutler Lab
Gene Symbol Sntg1
Ensembl Gene ENSMUSG00000025909
Gene Namesyntrophin, gamma 1
SynonymsSYN4, G1SYN
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location8361475-9299878 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8445119 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 397 (C397R)
Ref Sequence ENSEMBL: ENSMUSP00000141839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115488] [ENSMUST00000132064] [ENSMUST00000140295] [ENSMUST00000140302] [ENSMUST00000191683]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115484
SMART Domains Protein: ENSMUSP00000111147
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
PH 9 117 7.66e-1 SMART
low complexity region 165 174 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115488
AA Change: C398R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111151
Gene: ENSMUSG00000025909
AA Change: C398R

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 140 3.41e-17 SMART
PH 180 266 8.91e0 SMART
PH 284 392 7.66e-1 SMART
low complexity region 440 449 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132064
AA Change: C397R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122134
Gene: ENSMUSG00000025909
AA Change: C397R

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135046
SMART Domains Protein: ENSMUSP00000119420
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
Blast:PH 24 86 3e-40 BLAST
low complexity region 98 107 N/A INTRINSIC
low complexity region 157 172 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140295
AA Change: C398R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118101
Gene: ENSMUSG00000025909
AA Change: C398R

DomainStartEndE-ValueType
Blast:Tubulin_C 17 65 3e-20 BLAST
PDZ 77 150 1.84e-13 SMART
PH 190 276 8.91e0 SMART
PH 294 402 7.66e-1 SMART
low complexity region 450 459 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140302
SMART Domains Protein: ENSMUSP00000117397
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
PDZ 66 140 3.41e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191683
AA Change: C397R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141839
Gene: ENSMUSG00000025909
AA Change: C397R

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that typically contain 2 pleckstrin homology (PH) domains, a PDZ domain that bisects the first PH domain, and a C-terminal domain that mediates dystrophin binding. This family member plays a role in mediating gamma-enolase trafficking to the plasma membrane and in enhancing its neurotrophic activity. Mutations in this gene are associated with idiopathic scoliosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Sntg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Sntg1 APN 1 8595410 critical splice donor site probably null
IGL01536:Sntg1 APN 1 8583200 splice site probably null
IGL01558:Sntg1 APN 1 8463388 splice site probably benign
IGL01649:Sntg1 APN 1 8681969 splice site probably benign
IGL02230:Sntg1 APN 1 8681971 critical splice donor site probably null
IGL02252:Sntg1 APN 1 8414228 missense probably benign 0.00
IGL02804:Sntg1 APN 1 8803958 utr 5 prime probably benign
IGL03165:Sntg1 APN 1 8445104 missense probably damaging 1.00
IGL03400:Sntg1 APN 1 8463414 missense probably damaging 0.98
R0013:Sntg1 UTSW 1 8463462 missense probably damaging 1.00
R0079:Sntg1 UTSW 1 8679062 splice site probably benign
R0379:Sntg1 UTSW 1 8782824 missense probably damaging 1.00
R0551:Sntg1 UTSW 1 8554736 missense possibly damaging 0.73
R1645:Sntg1 UTSW 1 8803931 missense probably benign 0.06
R2089:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R2091:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R2091:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R3951:Sntg1 UTSW 1 8782901 splice site probably benign
R4152:Sntg1 UTSW 1 8583345 splice site probably null
R4153:Sntg1 UTSW 1 8583345 splice site probably null
R4154:Sntg1 UTSW 1 8583345 splice site probably null
R4847:Sntg1 UTSW 1 8595482 missense possibly damaging 0.93
R4888:Sntg1 UTSW 1 8363594 missense probably damaging 0.98
R4947:Sntg1 UTSW 1 8782798 missense probably damaging 1.00
R5065:Sntg1 UTSW 1 8363439 utr 3 prime probably benign
R5293:Sntg1 UTSW 1 8595533 missense probably damaging 1.00
R5550:Sntg1 UTSW 1 8624784 missense probably damaging 1.00
R5558:Sntg1 UTSW 1 8414271 missense possibly damaging 0.94
R5687:Sntg1 UTSW 1 8463443 missense possibly damaging 0.94
R5759:Sntg1 UTSW 1 8414270 missense probably benign 0.00
R6075:Sntg1 UTSW 1 8679114 makesense probably null
R6266:Sntg1 UTSW 1 8554729 missense possibly damaging 0.56
R6313:Sntg1 UTSW 1 8445024 splice site probably null
R6345:Sntg1 UTSW 1 8583284 missense possibly damaging 0.85
R6490:Sntg1 UTSW 1 8583284 missense possibly damaging 0.85
R6571:Sntg1 UTSW 1 8363528 utr 3 prime probably benign
R6736:Sntg1 UTSW 1 8445050 missense probably benign 0.16
R7112:Sntg1 UTSW 1 8448065 missense possibly damaging 0.93
R7266:Sntg1 UTSW 1 8682019 missense possibly damaging 0.81
R7414:Sntg1 UTSW 1 8448065 missense probably damaging 1.00
R7583:Sntg1 UTSW 1 8445025 critical splice donor site probably null
R7892:Sntg1 UTSW 1 8782800 missense probably damaging 1.00
R7961:Sntg1 UTSW 1 8363570 missense probably damaging 0.96
R7968:Sntg1 UTSW 1 8465536 nonsense probably null
R8009:Sntg1 UTSW 1 8363570 missense probably damaging 0.96
X0026:Sntg1 UTSW 1 8414247 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GGCTTTTCATGCATTCTTGAGTGACC -3'
(R):5'- CCTAAGCACGAGCTTTCAATGCCC -3'

Sequencing Primer
(F):5'- ATGCATTCTTGAGTGACCGTTTTG -3'
(R):5'- CGACCAGATATAACAATGTGTTAGG -3'
Posted On2014-01-29