Mutagenetix > Incidental Mutations

Incidental Mutation 'R1081:Sntg1'

152678

Institutional Source

Beutler Lab

Gene Symbol

Sntg1

Ensembl Gene

ENSMUSG00000025909

Gene Name

syntrophin, gamma 1

Synonyms

SYN4, G1SYN

MMRRC Submission

039167-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R1081 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8361475-9299878 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8445119 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 397 (C397R)

Ref Sequence

ENSEMBL: ENSMUSP00000141839 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115488] [ENSMUST00000132064] [ENSMUST00000140295] [ENSMUST00000140302] [ENSMUST00000191683]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000115484

SMART Domains

Protein: ENSMUSP00000111147
Gene: ENSMUSG00000025909

Domain	Start	End	E-Value	Type
PH	9	117	7.66e-1	SMART
low complexity region	165	174	N/A	INTRINSIC
low complexity region	224	239	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115488
AA Change: C398R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000111151
Gene: ENSMUSG00000025909
AA Change: C398R

Domain	Start	End	E-Value	Type
Blast:Tubulin_C	6	54	3e-20	BLAST
PDZ	66	140	3.41e-17	SMART
PH	180	266	8.91e0	SMART
PH	284	392	7.66e-1	SMART
low complexity region	440	449	N/A	INTRINSIC
low complexity region	499	514	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000132064
AA Change: C397R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000122134
Gene: ENSMUSG00000025909
AA Change: C397R

Domain	Start	End	E-Value	Type
Blast:Tubulin_C	6	54	3e-20	BLAST
PDZ	66	139	1.84e-13	SMART
PH	179	265	8.91e0	SMART
PH	283	391	7.66e-1	SMART
low complexity region	439	448	N/A	INTRINSIC
low complexity region	498	513	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135046

SMART Domains

Protein: ENSMUSP00000119420
Gene: ENSMUSG00000025909

Domain	Start	End	E-Value	Type
Blast:PH	24	86	3e-40	BLAST
low complexity region	98	107	N/A	INTRINSIC
low complexity region	157	172	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140295
AA Change: C398R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118101
Gene: ENSMUSG00000025909
AA Change: C398R

Domain	Start	End	E-Value	Type
Blast:Tubulin_C	17	65	3e-20	BLAST
PDZ	77	150	1.84e-13	SMART
PH	190	276	8.91e0	SMART
PH	294	402	7.66e-1	SMART
low complexity region	450	459	N/A	INTRINSIC
low complexity region	509	524	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140302

SMART Domains

Protein: ENSMUSP00000117397
Gene: ENSMUSG00000025909

Domain	Start	End	E-Value	Type
PDZ	66	140	3.41e-17	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000191683
AA Change: C397R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141839
Gene: ENSMUSG00000025909
AA Change: C397R

Domain	Start	End	E-Value	Type
Blast:Tubulin_C	6	54	3e-20	BLAST
PDZ	66	139	1.84e-13	SMART
PH	179	265	8.91e0	SMART
PH	283	391	7.66e-1	SMART
low complexity region	439	448	N/A	INTRINSIC
low complexity region	498	513	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that typically contain 2 pleckstrin homology (PH) domains, a PDZ domain that bisects the first PH domain, and a C-terminal domain that mediates dystrophin binding. This family member plays a role in mediating gamma-enolase trafficking to the plasma membrane and in enhancing its neurotrophic activity. Mutations in this gene are associated with idiopathic scoliosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,162,020	E309G	probably benign	Het
Abr	T	C	11: 76,455,615	K448E	probably damaging	Het
Atxn2l	T	C	7: 126,494,212	Y785C	probably damaging	Het
Atxn3	T	G	12: 101,934,349	D225A	probably damaging	Het
BC049730	T	C	7: 24,713,542		probably null	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cntnap5c	A	G	17: 58,305,525	D853G	possibly damaging	Het
Dnah9	A	G	11: 66,084,877	Y1449H	probably damaging	Het
Dsc2	T	G	18: 20,033,295	T760P	probably damaging	Het
Dync2h1	A	T	9: 7,005,488		probably null	Het
Epg5	T	C	18: 77,959,533	F611L	possibly damaging	Het
Fat3	T	C	9: 16,375,284	D981G	possibly damaging	Het
Gimap3	A	T	6: 48,765,152	C281*	probably null	Het
Ids	T	C	X: 70,361,110	D149G	possibly damaging	Het
Inpp4b	A	G	8: 82,069,024	I826V	probably damaging	Het
Kcnrg	C	A	14: 61,607,714	H68N	possibly damaging	Het
Klra6	A	G	6: 130,022,625	Y127H	probably damaging	Het
Mepce	A	G	5: 137,784,696	L456P	probably damaging	Het
Mink1	T	C	11: 70,607,035	L488P	probably benign	Het
Mndal	T	A	1: 173,860,222	E482V	probably benign	Het
Mob1b	G	A	5: 88,753,162	V143I	probably benign	Het
Msh4	T	C	3: 153,872,358	E433G	probably benign	Het
Myof	A	T	19: 37,986,088	I201N	probably damaging	Het
Naip1	G	A	13: 100,423,070	S1142F	probably benign	Het
Ntsr1	G	A	2: 180,538,756	S285N	probably benign	Het
Olfr319	C	T	11: 58,702,498	H266Y	probably damaging	Het
Olfr598	A	G	7: 103,329,038	Y184C	probably damaging	Het
Olfr66	T	A	7: 103,882,177	H22L	possibly damaging	Het
Olfr730	A	G	14: 50,187,197	S7P	probably damaging	Het
P2rx4	A	G	5: 122,727,233	E307G	probably damaging	Het
Pcdh15	A	G	10: 74,450,313	D793G	probably damaging	Het
Rpap1	G	A	2: 119,771,269	R737W	probably damaging	Het
Rpusd4	A	G	9: 35,275,088	K307E	probably benign	Het
Shtn1	T	A	19: 58,975,015	T623S	probably benign	Het
Stat5a	T	C	11: 100,881,060	F646S	probably damaging	Het
Tacc2	A	G	7: 130,728,574	E196G	possibly damaging	Het
Tcf25	T	C	8: 123,381,473	V89A	probably benign	Het
Trim7	G	T	11: 48,849,705	V210L	probably damaging	Het
Vmn2r57	A	G	7: 41,428,211	M177T	possibly damaging	Het
Wwc2	G	A	8: 47,828,764		probably benign	Het
Zfp28	A	G	7: 6,389,780	I152V	possibly damaging	Het
Zfp628	A	G	7: 4,920,183	H468R	probably damaging	Het
Zfp770	A	G	2: 114,197,127	Y154H	probably damaging	Het

Other mutations in Sntg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Sntg1	APN	1	8595410	critical splice donor site	probably null
IGL01536:Sntg1	APN	1	8583200	splice site	probably null
IGL01558:Sntg1	APN	1	8463388	splice site	probably benign
IGL01649:Sntg1	APN	1	8681969	splice site	probably benign
IGL02230:Sntg1	APN	1	8681971	critical splice donor site	probably null
IGL02252:Sntg1	APN	1	8414228	missense	probably benign	0.00
IGL02804:Sntg1	APN	1	8803958	utr 5 prime	probably benign
IGL03165:Sntg1	APN	1	8445104	missense	probably damaging	1.00
IGL03400:Sntg1	APN	1	8463414	missense	probably damaging	0.98
R0013:Sntg1	UTSW	1	8463462	missense	probably damaging	1.00
R0079:Sntg1	UTSW	1	8679062	splice site	probably benign
R0379:Sntg1	UTSW	1	8782824	missense	probably damaging	1.00
R0551:Sntg1	UTSW	1	8554736	missense	possibly damaging	0.73
R1645:Sntg1	UTSW	1	8803931	missense	probably benign	0.06
R2089:Sntg1	UTSW	1	8595539	missense	probably benign	0.04
R2091:Sntg1	UTSW	1	8595539	missense	probably benign	0.04
R2091:Sntg1	UTSW	1	8595539	missense	probably benign	0.04
R3951:Sntg1	UTSW	1	8782901	splice site	probably benign
R4152:Sntg1	UTSW	1	8583345	splice site	probably null
R4153:Sntg1	UTSW	1	8583345	splice site	probably null
R4154:Sntg1	UTSW	1	8583345	splice site	probably null
R4847:Sntg1	UTSW	1	8595482	missense	possibly damaging	0.93
R4888:Sntg1	UTSW	1	8363594	missense	probably damaging	0.98
R4947:Sntg1	UTSW	1	8782798	missense	probably damaging	1.00
R5065:Sntg1	UTSW	1	8363439	utr 3 prime	probably benign
R5293:Sntg1	UTSW	1	8595533	missense	probably damaging	1.00
R5550:Sntg1	UTSW	1	8624784	missense	probably damaging	1.00
R5558:Sntg1	UTSW	1	8414271	missense	possibly damaging	0.94
R5687:Sntg1	UTSW	1	8463443	missense	possibly damaging	0.94
R5759:Sntg1	UTSW	1	8414270	missense	probably benign	0.00
R6075:Sntg1	UTSW	1	8679114	makesense	probably null
R6266:Sntg1	UTSW	1	8554729	missense	possibly damaging	0.56
R6313:Sntg1	UTSW	1	8445024	splice site	probably null
R6345:Sntg1	UTSW	1	8583284	missense	possibly damaging	0.85
R6490:Sntg1	UTSW	1	8583284	missense	possibly damaging	0.85
R6571:Sntg1	UTSW	1	8363528	utr 3 prime	probably benign
R6736:Sntg1	UTSW	1	8445050	missense	probably benign	0.16
R7112:Sntg1	UTSW	1	8448065	missense	possibly damaging	0.93
R7266:Sntg1	UTSW	1	8682019	missense	possibly damaging	0.81
R7414:Sntg1	UTSW	1	8448065	missense	probably damaging	1.00
R7583:Sntg1	UTSW	1	8445025	critical splice donor site	probably null
R7892:Sntg1	UTSW	1	8782800	missense	probably damaging	1.00
R7961:Sntg1	UTSW	1	8363570	missense	probably damaging	0.96
R7968:Sntg1	UTSW	1	8465536	nonsense	probably null
R8009:Sntg1	UTSW	1	8363570	missense	probably damaging	0.96
X0026:Sntg1	UTSW	1	8414247	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- GGCTTTTCATGCATTCTTGAGTGACC -3'
(R):5'- CCTAAGCACGAGCTTTCAATGCCC -3'

Sequencing Primer
(F):5'- ATGCATTCTTGAGTGACCGTTTTG -3'
(R):5'- CGACCAGATATAACAATGTGTTAGG -3'

Posted On

2014-01-29