Mutagenetix > Incidental Mutations

Incidental Mutation 'R1081:Inpp4b'

152702

Institutional Source

Beutler Lab

Gene Symbol

Inpp4b

Ensembl Gene

ENSMUSG00000037940

Gene Name

inositol polyphosphate-4-phosphatase, type II

Synonyms

E130107I17Rik

MMRRC Submission

039167-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R1081 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81342556-82127914 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 82069024 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 826 (I826V)

Ref Sequence

ENSEMBL: ENSMUSP00000148972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109851] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000172031] [ENSMUST00000213285] [ENSMUST00000215332] [ENSMUST00000217122]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042529
AA Change: I809V

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: I809V

Domain	Start	End	E-Value	Type
C2	40	147	1.72e0	SMART
low complexity region	302	319	N/A	INTRINSIC
low complexity region	425	434	N/A	INTRINSIC
transmembrane domain	898	920	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109851
AA Change: I694V

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105477
Gene: ENSMUSG00000037940
AA Change: I694V

Domain	Start	End	E-Value	Type
low complexity region	22	35	N/A	INTRINSIC
low complexity region	187	204	N/A	INTRINSIC
low complexity region	310	319	N/A	INTRINSIC
transmembrane domain	783	805	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109852
AA Change: I826V

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: I826V

Domain	Start	End	E-Value	Type
C2	40	164	5.29e0	SMART
low complexity region	319	336	N/A	INTRINSIC
low complexity region	442	451	N/A	INTRINSIC
transmembrane domain	915	937	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169116

SMART Domains

Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940

Domain	Start	End	E-Value	Type
C2	40	164	5.29e0	SMART
low complexity region	319	336	N/A	INTRINSIC
low complexity region	442	451	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169387

Predicted Effect

probably benign
Transcript: ENSMUST00000170160

SMART Domains

Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940

Domain	Start	End	E-Value	Type
low complexity region	134	151	N/A	INTRINSIC
low complexity region	257	266	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172031
AA Change: I826V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: I826V

Domain	Start	End	E-Value	Type
C2	40	164	5.29e0	SMART
low complexity region	319	336	N/A	INTRINSIC
low complexity region	442	451	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000213285

Predicted Effect

probably damaging
Transcript: ENSMUST00000215332
AA Change: I826V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217122
AA Change: I826V

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,162,020	E309G	probably benign	Het
Abr	T	C	11: 76,455,615	K448E	probably damaging	Het
Atxn2l	T	C	7: 126,494,212	Y785C	probably damaging	Het
Atxn3	T	G	12: 101,934,349	D225A	probably damaging	Het
BC049730	T	C	7: 24,713,542		probably null	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cntnap5c	A	G	17: 58,305,525	D853G	possibly damaging	Het
Dnah9	A	G	11: 66,084,877	Y1449H	probably damaging	Het
Dsc2	T	G	18: 20,033,295	T760P	probably damaging	Het
Dync2h1	A	T	9: 7,005,488		probably null	Het
Epg5	T	C	18: 77,959,533	F611L	possibly damaging	Het
Fat3	T	C	9: 16,375,284	D981G	possibly damaging	Het
Gimap3	A	T	6: 48,765,152	C281*	probably null	Het
Ids	T	C	X: 70,361,110	D149G	possibly damaging	Het
Kcnrg	C	A	14: 61,607,714	H68N	possibly damaging	Het
Klra6	A	G	6: 130,022,625	Y127H	probably damaging	Het
Mepce	A	G	5: 137,784,696	L456P	probably damaging	Het
Mink1	T	C	11: 70,607,035	L488P	probably benign	Het
Mndal	T	A	1: 173,860,222	E482V	probably benign	Het
Mob1b	G	A	5: 88,753,162	V143I	probably benign	Het
Msh4	T	C	3: 153,872,358	E433G	probably benign	Het
Myof	A	T	19: 37,986,088	I201N	probably damaging	Het
Naip1	G	A	13: 100,423,070	S1142F	probably benign	Het
Ntsr1	G	A	2: 180,538,756	S285N	probably benign	Het
Olfr319	C	T	11: 58,702,498	H266Y	probably damaging	Het
Olfr598	A	G	7: 103,329,038	Y184C	probably damaging	Het
Olfr66	T	A	7: 103,882,177	H22L	possibly damaging	Het
Olfr730	A	G	14: 50,187,197	S7P	probably damaging	Het
P2rx4	A	G	5: 122,727,233	E307G	probably damaging	Het
Pcdh15	A	G	10: 74,450,313	D793G	probably damaging	Het
Rpap1	G	A	2: 119,771,269	R737W	probably damaging	Het
Rpusd4	A	G	9: 35,275,088	K307E	probably benign	Het
Shtn1	T	A	19: 58,975,015	T623S	probably benign	Het
Sntg1	A	G	1: 8,445,119	C397R	possibly damaging	Het
Stat5a	T	C	11: 100,881,060	F646S	probably damaging	Het
Tacc2	A	G	7: 130,728,574	E196G	possibly damaging	Het
Tcf25	T	C	8: 123,381,473	V89A	probably benign	Het
Trim7	G	T	11: 48,849,705	V210L	probably damaging	Het
Vmn2r57	A	G	7: 41,428,211	M177T	possibly damaging	Het
Wwc2	G	A	8: 47,828,764		probably benign	Het
Zfp28	A	G	7: 6,389,780	I152V	possibly damaging	Het
Zfp628	A	G	7: 4,920,183	H468R	probably damaging	Het
Zfp770	A	G	2: 114,197,127	Y154H	probably damaging	Het

Other mutations in Inpp4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Inpp4b	APN	8	81856750	missense	probably damaging	1.00
IGL01481:Inpp4b	APN	8	81997380	missense	probably damaging	1.00
IGL01509:Inpp4b	APN	8	81890703	splice site	probably benign
IGL01515:Inpp4b	APN	8	81952711	missense	possibly damaging	0.68
IGL01607:Inpp4b	APN	8	82010663	missense	probably benign	0.03
IGL01643:Inpp4b	APN	8	82071771	missense	probably damaging	0.97
IGL01736:Inpp4b	APN	8	81997339	missense	probably benign	0.00
IGL02154:Inpp4b	APN	8	81969501	splice site	probably benign
IGL02327:Inpp4b	APN	8	82041962	missense	probably benign	0.01
IGL02413:Inpp4b	APN	8	82033171	missense	probably benign
IGL02652:Inpp4b	APN	8	81770800	splice site	probably benign
IGL02678:Inpp4b	APN	8	81856744	missense	probably damaging	1.00
IGL03146:Inpp4b	APN	8	81743781	missense	possibly damaging	0.61
LCD18:Inpp4b	UTSW	8	81693010	intron	probably benign
PIT4280001:Inpp4b	UTSW	8	82034417	missense	probably benign	0.00
PIT4480001:Inpp4b	UTSW	8	82046267	missense	probably damaging	1.00
PIT4504001:Inpp4b	UTSW	8	82041935	missense	probably damaging	1.00
R0083:Inpp4b	UTSW	8	81741462	missense	possibly damaging	0.77
R0212:Inpp4b	UTSW	8	81770917	missense	probably benign	0.00
R0285:Inpp4b	UTSW	8	82034516	splice site	probably benign
R0363:Inpp4b	UTSW	8	81884257	splice site	probably benign
R0364:Inpp4b	UTSW	8	81997314	missense	probably benign	0.09
R0471:Inpp4b	UTSW	8	82041899	missense	possibly damaging	0.94
R0550:Inpp4b	UTSW	8	81997337	missense	probably benign	0.00
R0562:Inpp4b	UTSW	8	81768151	missense	possibly damaging	0.88
R0661:Inpp4b	UTSW	8	81741462	missense	possibly damaging	0.77
R0693:Inpp4b	UTSW	8	81997314	missense	probably benign	0.09
R1251:Inpp4b	UTSW	8	81890753	missense	probably benign	0.01
R1374:Inpp4b	UTSW	8	81743816	critical splice donor site	probably null
R1445:Inpp4b	UTSW	8	81952834	splice site	probably null
R1465:Inpp4b	UTSW	8	81768157	missense	probably damaging	1.00
R1465:Inpp4b	UTSW	8	81768157	missense	probably damaging	1.00
R1647:Inpp4b	UTSW	8	81856774	splice site	probably benign
R1754:Inpp4b	UTSW	8	81770811	missense	probably damaging	1.00
R1759:Inpp4b	UTSW	8	81768103	missense	probably benign	0.06
R2085:Inpp4b	UTSW	8	81952274	missense	probably damaging	1.00
R2156:Inpp4b	UTSW	8	82048489	missense	probably damaging	1.00
R2160:Inpp4b	UTSW	8	82121375	nonsense	probably null
R2175:Inpp4b	UTSW	8	81856699	missense	probably damaging	1.00
R2191:Inpp4b	UTSW	8	81997302	missense	probably damaging	1.00
R2401:Inpp4b	UTSW	8	81997339	missense	probably benign	0.00
R2475:Inpp4b	UTSW	8	82041978	missense	probably benign	0.09
R2512:Inpp4b	UTSW	8	82010550	missense	probably damaging	1.00
R2919:Inpp4b	UTSW	8	81985329	missense	possibly damaging	0.93
R3021:Inpp4b	UTSW	8	81902838	missense	possibly damaging	0.47
R3423:Inpp4b	UTSW	8	81952261	missense	possibly damaging	0.63
R3777:Inpp4b	UTSW	8	82041992	missense	possibly damaging	0.89
R3778:Inpp4b	UTSW	8	82041992	missense	possibly damaging	0.89
R3794:Inpp4b	UTSW	8	82033216	missense	probably damaging	1.00
R3795:Inpp4b	UTSW	8	82033216	missense	probably damaging	1.00
R4590:Inpp4b	UTSW	8	81741411	start codon destroyed	probably null	1.00
R4602:Inpp4b	UTSW	8	81969535	missense	probably damaging	0.99
R4691:Inpp4b	UTSW	8	82122653	missense	probably damaging	1.00
R4924:Inpp4b	UTSW	8	82122624	missense	probably damaging	1.00
R4992:Inpp4b	UTSW	8	82033208	missense	probably damaging	1.00
R5219:Inpp4b	UTSW	8	81884156	missense	probably benign	0.01
R5228:Inpp4b	UTSW	8	81768115	missense	probably damaging	0.99
R5557:Inpp4b	UTSW	8	81952259	missense	probably damaging	0.99
R5627:Inpp4b	UTSW	8	81743816	critical splice donor site	probably benign
R5691:Inpp4b	UTSW	8	81890694	intron	probably benign
R6186:Inpp4b	UTSW	8	82046234	missense	probably damaging	0.99
R6213:Inpp4b	UTSW	8	81997390	missense	probably damaging	1.00
R6232:Inpp4b	UTSW	8	81952184	missense	probably damaging	1.00
R6283:Inpp4b	UTSW	8	81770833	missense	probably damaging	1.00
R6302:Inpp4b	UTSW	8	81768177	missense	probably benign	0.00
R6309:Inpp4b	UTSW	8	82041917	missense	probably damaging	1.00
R6360:Inpp4b	UTSW	8	81902852	missense	probably benign	0.20
R6477:Inpp4b	UTSW	8	81844714	splice site	probably null
R6773:Inpp4b	UTSW	8	81856620	intron	probably benign
R6968:Inpp4b	UTSW	8	81844457	missense	probably benign	0.18
R7147:Inpp4b	UTSW	8	81902771	missense	probably damaging	1.00
R7318:Inpp4b	UTSW	8	82071745	missense	probably damaging	1.00
R7409:Inpp4b	UTSW	8	81952685	splice site	probably null
R7455:Inpp4b	UTSW	8	82071703	missense	probably damaging	0.99
R7632:Inpp4b	UTSW	8	82046339	missense	probably damaging	1.00
R7844:Inpp4b	UTSW	8	81741320	start gained	probably benign
R7958:Inpp4b	UTSW	8	81969589	missense	probably damaging	1.00
R8440:Inpp4b	UTSW	8	82041895	missense	probably damaging	1.00
RF003:Inpp4b	UTSW	8	81969521	nonsense	probably null
Z1088:Inpp4b	UTSW	8	82068931	critical splice acceptor site	probably null
Z1176:Inpp4b	UTSW	8	82069001	missense	possibly damaging	0.60

Predicted Primers

PCR Primer
(F):5'- GCAAGACATTTCTGGCACATACTGC -3'
(R):5'- AACCCAAAGTCGGTAAGGAGCGTC -3'

Sequencing Primer
(F):5'- TTCTGGCACATACTGCCTAAAG -3'
(R):5'- AGCGTCAATCAGGAGTATTTTCCC -3'

Posted On

2014-01-29