Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:Kcnma1'

160005

Institutional Source

Beutler Lab

Gene Symbol

Kcnma1

Ensembl Gene

ENSMUSG00000063142

Gene Name

potassium large conductance calcium-activated channel, subfamily M, alpha member 1

Synonyms

mSlo1, MaxiK, Slo1, 5730414M22Rik, BK channel alpha subunit, BKCa, Slo

MMRRC Submission

039475-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.799) question?

Stock #

R1419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23289431-24014491 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23367642 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 713 (T713A)

Ref Sequence

ENSEMBL: ENSMUSP00000153316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065788] [ENSMUST00000074983] [ENSMUST00000100831] [ENSMUST00000112423] [ENSMUST00000145596] [ENSMUST00000163322] [ENSMUST00000172099] [ENSMUST00000177634] [ENSMUST00000179097] [ENSMUST00000179836] [ENSMUST00000188285] [ENSMUST00000190044] [ENSMUST00000188991] [ENSMUST00000188210] [ENSMUST00000224077] [ENSMUST00000225471] [ENSMUST00000225315] [ENSMUST00000224285] [ENSMUST00000223749] [ENSMUST00000224787] [ENSMUST00000224232] [ENSMUST00000224468] [ENSMUST00000223727] [ENSMUST00000225431] [ENSMUST00000223655] [ENSMUST00000224812] [ENSMUST00000225556] [ENSMUST00000225794] [ENSMUST00000190985]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065788
AA Change: T656A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000065293
Gene: ENSMUSG00000063142
AA Change: T656A

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
transmembrane domain	54	73	N/A	INTRINSIC
Pfam:Ion_trans	91	262	2.2e-18	PFAM
Pfam:Ion_trans_2	180	268	5.7e-16	PFAM
Pfam:TrkA_N	314	413	7.5e-7	PFAM
Pfam:BK_channel_a	411	509	6.4e-31	PFAM
low complexity region	835	843	N/A	INTRINSIC
low complexity region	891	902	N/A	INTRINSIC
low complexity region	1005	1031	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000074983
AA Change: T715A

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000074511
Gene: ENSMUSG00000063142
AA Change: T715A

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
transmembrane domain	54	73	N/A	INTRINSIC
Pfam:Ion_trans	91	262	2.2e-18	PFAM
Pfam:Ion_trans_2	180	268	5.7e-16	PFAM
Pfam:TrkA_N	314	413	7.5e-7	PFAM
Pfam:BK_channel_a	411	509	6.4e-31	PFAM
low complexity region	894	902	N/A	INTRINSIC
low complexity region	950	961	N/A	INTRINSIC
low complexity region	1064	1090	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100831
AA Change: T686A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000098393
Gene: ENSMUSG00000063142
AA Change: T686A

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
transmembrane domain	54	73	N/A	INTRINSIC
Pfam:Ion_trans	91	262	2.1e-18	PFAM
Pfam:Ion_trans_2	180	268	5.5e-16	PFAM
Pfam:TrkA_N	314	413	7.3e-7	PFAM
Pfam:BK_channel_a	411	509	6.2e-31	PFAM
low complexity region	865	873	N/A	INTRINSIC
low complexity region	921	932	N/A	INTRINSIC
low complexity region	1035	1061	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112423
AA Change: T602A

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108042
Gene: ENSMUSG00000063142
AA Change: T602A

Domain	Start	End	E-Value	Type
transmembrane domain	2	19	N/A	INTRINSIC
Pfam:Ion_trans	37	208	2.1e-18	PFAM
Pfam:Ion_trans_2	126	214	5.3e-16	PFAM
Pfam:TrkA_N	260	359	7e-7	PFAM
Pfam:BK_channel_a	357	455	6e-31	PFAM
low complexity region	781	789	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	951	977	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145596
AA Change: T782A

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163322
AA Change: T653A

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000128553
Gene: ENSMUSG00000063142
AA Change: T653A

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
transmembrane domain	54	73	N/A	INTRINSIC
Pfam:Ion_trans	91	262	3.2e-18	PFAM
Pfam:Ion_trans_2	180	268	1.1e-15	PFAM
Pfam:TrkA_N	314	413	7e-7	PFAM
Pfam:BK_channel_a	411	509	6e-31	PFAM
low complexity region	832	840	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	1002	1028	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172099
AA Change: T718A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000132204
Gene: ENSMUSG00000063142
AA Change: T718A

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
transmembrane domain	54	73	N/A	INTRINSIC
Pfam:Ion_trans	91	262	2.2e-18	PFAM
Pfam:Ion_trans_2	180	268	5.7e-16	PFAM
Pfam:TrkA_N	314	413	7.6e-7	PFAM
Pfam:BK_channel_a	411	509	6.5e-31	PFAM
low complexity region	897	905	N/A	INTRINSIC
low complexity region	953	964	N/A	INTRINSIC
low complexity region	1067	1093	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177634
AA Change: T656A

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000136447
Gene: ENSMUSG00000063142
AA Change: T656A

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
Pfam:Ion_trans	53	272	4.9e-19	PFAM
Pfam:Ion_trans_2	180	267	1.2e-15	PFAM
Pfam:BK_channel_a	413	508	1.2e-35	PFAM
low complexity region	862	870	N/A	INTRINSIC
low complexity region	918	929	N/A	INTRINSIC
low complexity region	1032	1058	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179097
AA Change: T653A

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000136568
Gene: ENSMUSG00000063142
AA Change: T653A

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
transmembrane domain	54	73	N/A	INTRINSIC
Pfam:Ion_trans	91	262	4.6e-18	PFAM
Pfam:Ion_trans_2	180	268	1e-15	PFAM
Pfam:TrkA_N	314	413	1.1e-7	PFAM
Pfam:BK_channel_a	411	509	3.2e-31	PFAM
low complexity region	859	867	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	1029	1055	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179836
AA Change: T659A

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000137141
Gene: ENSMUSG00000063142
AA Change: T659A

Domain	Start	End	E-Value	Type
low complexity region	20	31	N/A	INTRINSIC
transmembrane domain	54	73	N/A	INTRINSIC
Pfam:Ion_trans	91	262	4.2e-18	PFAM
Pfam:Ion_trans_2	180	268	9.5e-16	PFAM
Pfam:BK_channel_a	389	457	2.4e-15	PFAM
low complexity region	838	846	N/A	INTRINSIC
low complexity region	894	905	N/A	INTRINSIC
low complexity region	1008	1034	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188285
AA Change: T840A

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142
AA Change: T840A

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
transmembrane domain	179	198	N/A	INTRINSIC
Pfam:Ion_trans	216	387	1.3e-18	PFAM
Pfam:Ion_trans_2	305	393	5.4e-16	PFAM
Pfam:TrkA_N	439	538	8e-7	PFAM
Pfam:BK_channel_a	536	634	5.2e-31	PFAM
low complexity region	1019	1027	N/A	INTRINSIC
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1189	1215	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190044
AA Change: T778A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142
AA Change: T778A

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
transmembrane domain	179	198	N/A	INTRINSIC
Pfam:Ion_trans	216	387	1.3e-18	PFAM
Pfam:Ion_trans_2	305	393	5.1e-16	PFAM
Pfam:TrkA_N	439	538	7.5e-7	PFAM
Pfam:BK_channel_a	536	634	4.9e-31	PFAM
low complexity region	957	965	N/A	INTRINSIC
low complexity region	1013	1024	N/A	INTRINSIC
low complexity region	1127	1153	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188991
AA Change: T836A

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142
AA Change: T836A

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
transmembrane domain	179	198	N/A	INTRINSIC
Pfam:Ion_trans	216	387	3.3e-18	PFAM
Pfam:Ion_trans_2	305	393	1.1e-15	PFAM
Pfam:TrkA_N	439	538	3.7e-7	PFAM
Pfam:BK_channel_a	536	634	3.4e-31	PFAM
low complexity region	1015	1023	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1185	1211	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188210
AA Change: T713A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142
AA Change: T713A

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
transmembrane domain	86	108	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
transmembrane domain	179	198	N/A	INTRINSIC
Pfam:Ion_trans	216	387	1.3e-18	PFAM
Pfam:Ion_trans_2	305	393	5.2e-16	PFAM
Pfam:TrkA_N	439	538	7.8e-7	PFAM
Pfam:BK_channel_a	536	634	5e-31	PFAM
low complexity region	988	996	N/A	INTRINSIC
low complexity region	1044	1055	N/A	INTRINSIC
low complexity region	1158	1184	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224077
AA Change: T778A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225471
AA Change: T742A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225315
AA Change: T742A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224285
AA Change: T713A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Predicted Effect

unknown
Transcript: ENSMUST00000224025
AA Change: T731A

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223749
AA Change: T713A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

probably damaging
Transcript: ENSMUST00000224787
AA Change: T662A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000224232
AA Change: T771A

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224468
AA Change: T843A

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223727
AA Change: T713A

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225431
AA Change: T713A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223655
AA Change: T775A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224812
AA Change: T746A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225556
AA Change: T719A

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000225794

Predicted Effect

probably benign
Transcript: ENSMUST00000190985

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Ablim1	C	A	19: 57,134,633	C173F	probably damaging	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
AI481877	T	C	4: 59,064,457	T826A	possibly damaging	Het
Arap3	T	C	18: 37,978,432	T1144A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Atm	A	C	9: 53,457,489	N2337K	probably benign	Het
Cog7	T	C	7: 121,955,992	E316G	probably damaging	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ift80	T	A	3: 68,940,198	N322Y	probably damaging	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Klhl14	C	A	18: 21,652,193	R59L	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Myof	T	C	19: 37,901,911	E1971G	probably damaging	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Paip1	A	G	13: 119,457,017	D189G	probably damaging	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tktl2	A	G	8: 66,513,038	N416S	probably damaging	Het
Tm7sf3	T	A	6: 146,603,977	I494F	possibly damaging	Het
Trf	C	T	9: 103,226,108	V119M	probably damaging	Het

Other mutations in Kcnma1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01318:Kcnma1	APN	14	23314322	splice site	probably benign
IGL01520:Kcnma1	APN	14	23501143	missense	possibly damaging	0.94
IGL01977:Kcnma1	APN	14	23530299	splice site	probably benign
IGL02140:Kcnma1	APN	14	23309045	missense	probably damaging	1.00
IGL02165:Kcnma1	APN	14	23336967	missense	possibly damaging	0.93
IGL02186:Kcnma1	APN	14	23526813	missense	probably benign	0.28
IGL02268:Kcnma1	APN	14	23543076	missense	probably damaging	1.00
IGL02353:Kcnma1	APN	14	23591613	missense	probably damaging	1.00
IGL02360:Kcnma1	APN	14	23591613	missense	probably damaging	1.00
IGL02491:Kcnma1	APN	14	23311689	missense	probably damaging	1.00
IGL02552:Kcnma1	APN	14	23386259	critical splice donor site	probably null
IGL02625:Kcnma1	APN	14	23363832	missense	probably damaging	1.00
IGL02677:Kcnma1	APN	14	23463156	missense	probably damaging	1.00
IGL02706:Kcnma1	APN	14	23309154	missense	probably damaging	1.00
G1citation:Kcnma1	UTSW	14	24003744	splice site	probably null
PIT4495001:Kcnma1	UTSW	14	23425597	missense	probably benign	0.00
PIT4514001:Kcnma1	UTSW	14	23309035	splice site	probably null
PIT4576001:Kcnma1	UTSW	14	23309035	splice site	probably null
R0071:Kcnma1	UTSW	14	23526767	missense	probably damaging	1.00
R0071:Kcnma1	UTSW	14	23526767	missense	probably damaging	1.00
R0115:Kcnma1	UTSW	14	23314175	missense	probably damaging	1.00
R0172:Kcnma1	UTSW	14	23803166	missense	probably damaging	1.00
R0178:Kcnma1	UTSW	14	23526767	missense	probably damaging	1.00
R0183:Kcnma1	UTSW	14	23508052	missense	probably damaging	1.00
R0240:Kcnma1	UTSW	14	23494579	missense	probably damaging	1.00
R0240:Kcnma1	UTSW	14	23494579	missense	probably damaging	1.00
R0328:Kcnma1	UTSW	14	23373197	missense	probably damaging	1.00
R0501:Kcnma1	UTSW	14	23311716	missense	possibly damaging	0.80
R0631:Kcnma1	UTSW	14	23509784	splice site	probably benign
R0668:Kcnma1	UTSW	14	23367495	missense	probably damaging	1.00
R0811:Kcnma1	UTSW	14	23300018	missense	probably damaging	0.96
R0812:Kcnma1	UTSW	14	23300018	missense	probably damaging	0.96
R1080:Kcnma1	UTSW	14	23494607	missense	probably damaging	1.00
R1446:Kcnma1	UTSW	14	23311724	missense	probably damaging	1.00
R1454:Kcnma1	UTSW	14	23463200	missense	probably damaging	1.00
R1651:Kcnma1	UTSW	14	23314194	missense	probably damaging	1.00
R1826:Kcnma1	UTSW	14	23330929	missense	probably damaging	1.00
R1827:Kcnma1	UTSW	14	23330929	missense	probably damaging	1.00
R1828:Kcnma1	UTSW	14	23330929	missense	probably damaging	1.00
R1864:Kcnma1	UTSW	14	23803162	missense	probably damaging	1.00
R2002:Kcnma1	UTSW	14	23337029	missense	probably damaging	0.99
R2140:Kcnma1	UTSW	14	23314220	missense	probably damaging	1.00
R2278:Kcnma1	UTSW	14	23543083	nonsense	probably null
R2866:Kcnma1	UTSW	14	23373207	missense	probably benign	0.16
R2867:Kcnma1	UTSW	14	23373207	missense	probably benign	0.16
R2867:Kcnma1	UTSW	14	23373207	missense	probably benign	0.16
R2900:Kcnma1	UTSW	14	23803160	missense	probably damaging	1.00
R3820:Kcnma1	UTSW	14	23299938	missense	possibly damaging	0.66
R3821:Kcnma1	UTSW	14	23367611	missense	probably damaging	1.00
R3901:Kcnma1	UTSW	14	23505255	missense	probably damaging	0.98
R3975:Kcnma1	UTSW	14	24003747	critical splice donor site	probably null
R3976:Kcnma1	UTSW	14	24003747	critical splice donor site	probably null
R4352:Kcnma1	UTSW	14	23311652	missense	probably damaging	1.00
R4517:Kcnma1	UTSW	14	23337029	missense	probably damaging	1.00
R4598:Kcnma1	UTSW	14	23803160	missense	probably damaging	1.00
R4604:Kcnma1	UTSW	14	23309038	critical splice donor site	probably null
R4743:Kcnma1	UTSW	14	23803202	missense	probably damaging	1.00
R4754:Kcnma1	UTSW	14	23363836	missense	probably damaging	0.96
R4908:Kcnma1	UTSW	14	23309152	missense	probably damaging	0.99
R4960:Kcnma1	UTSW	14	24004118	intron	probably benign
R5175:Kcnma1	UTSW	14	23336038	critical splice donor site	probably null
R5218:Kcnma1	UTSW	14	23463185	missense	probably damaging	0.96
R5435:Kcnma1	UTSW	14	23528404	nonsense	probably null
R5705:Kcnma1	UTSW	14	24003771	missense	possibly damaging	0.73
R5746:Kcnma1	UTSW	14	23494567	missense	probably damaging	1.00
R5780:Kcnma1	UTSW	14	23386351	nonsense	probably null
R5793:Kcnma1	UTSW	14	23309035	splice site	probably null
R6039:Kcnma1	UTSW	14	23309037	missense	probably benign	0.42
R6039:Kcnma1	UTSW	14	23309037	missense	probably benign	0.42
R6133:Kcnma1	UTSW	14	24003868	missense	probably damaging	0.98
R6271:Kcnma1	UTSW	14	23509889	missense	probably damaging	1.00
R6490:Kcnma1	UTSW	14	23336097	missense	possibly damaging	0.46
R6704:Kcnma1	UTSW	14	24002814	nonsense	probably null
R6822:Kcnma1	UTSW	14	24003744	splice site	probably null
R6855:Kcnma1	UTSW	14	23367611	missense	probably damaging	1.00
R6920:Kcnma1	UTSW	14	23526534	critical splice donor site	probably null
R7017:Kcnma1	UTSW	14	23494643	missense	possibly damaging	0.79
R7081:Kcnma1	UTSW	14	23300018	missense	probably damaging	0.96
R7113:Kcnma1	UTSW	14	23463156	missense	probably damaging	1.00
R7131:Kcnma1	UTSW	14	23367494	missense	probably damaging	1.00
R7172:Kcnma1	UTSW	14	23526623	missense	probably damaging	1.00
R7207:Kcnma1	UTSW	14	23309015	makesense	probably null
R7308:Kcnma1	UTSW	14	23330935	missense	probably damaging	0.99
R7371:Kcnma1	UTSW	14	23494570	missense	possibly damaging	0.94
R7404:Kcnma1	UTSW	14	24002834	missense	unknown
R7560:Kcnma1	UTSW	14	23530242	missense	probably benign	0.15
R7693:Kcnma1	UTSW	14	23367612	missense	probably damaging	1.00
R7763:Kcnma1	UTSW	14	23300006	missense	possibly damaging	0.66
R7809:Kcnma1	UTSW	14	23373256	missense	probably benign	0.16
R7832:Kcnma1	UTSW	14	23390923	missense	probably benign
R7884:Kcnma1	UTSW	14	23336989	missense	probably benign	0.01
R8013:Kcnma1	UTSW	14	23373143	missense	probably benign	0.31
R8014:Kcnma1	UTSW	14	23373143	missense	probably benign	0.31
R8066:Kcnma1	UTSW	14	23311676	missense	probably benign	0.00
R8097:Kcnma1	UTSW	14	23330964	missense	probably damaging	1.00
R8154:Kcnma1	UTSW	14	23311754	missense	possibly damaging	0.62
R8507:Kcnma1	UTSW	14	23591638	missense	probably benign	0.00
R8672:Kcnma1	UTSW	14	23501162	missense	probably damaging	1.00
R8677:Kcnma1	UTSW	14	23386350	missense	probably benign	0.36
R8725:Kcnma1	UTSW	14	23386264	missense	probably benign	0.00
R8727:Kcnma1	UTSW	14	23386264	missense	probably benign	0.00
R8827:Kcnma1	UTSW	14	23367480	missense	probably damaging	1.00
R8880:Kcnma1	UTSW	14	23367650	missense	probably damaging	1.00
R8997:Kcnma1	UTSW	14	23462969	intron	probably benign
R9056:Kcnma1	UTSW	14	23650146	missense	possibly damaging	0.80
R9346:Kcnma1	UTSW	14	23650165	missense	possibly damaging	0.94
R9403:Kcnma1	UTSW	14	23543077	missense	probably benign	0.05
R9438:Kcnma1	UTSW	14	23367585	missense	probably benign	0.00
R9482:Kcnma1	UTSW	14	23390965	missense	probably benign
R9511:Kcnma1	UTSW	14	23311725	missense	possibly damaging	0.90
R9649:Kcnma1	UTSW	14	23451598	critical splice donor site	probably null
R9663:Kcnma1	UTSW	14	24003829	missense	probably benign	0.15
R9673:Kcnma1	UTSW	14	23508055	missense	probably benign	0.01
RF001:Kcnma1	UTSW	14	23311697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTAGCTCAACTTCACCCGACAAG -3'
(R):5'- AACCACAGCAGTGGTCCACAGTAG -3'

Sequencing Primer
(F):5'- ATAGTGCGACTTGACTTACAGGC -3'
(R):5'- TCCACAGTAGGTGGTCAATG -3'

Posted On

2014-03-14