Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:Myof'

160014

Institutional Source

Beutler Lab

Gene Symbol

Myof

Ensembl Gene

ENSMUSG00000048612

Gene Name

myoferlin

Synonyms

Fer1l3, E030042N20Rik, 2310051D19Rik

MMRRC Submission

039475-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37899036-38043577 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37901911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1971 (E1971G)

Ref Sequence

ENSEMBL: ENSMUSP00000153225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000224560] [ENSMUST00000225159] [ENSMUST00000226068]

AlphaFold

Q69ZN7

Predicted Effect

probably damaging
Transcript: ENSMUST00000041475
AA Change: E1958G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: E1958G

Domain	Start	End	E-Value	Type
C2	1	100	7.56e-16	SMART
low complexity region	142	159	N/A	INTRINSIC
C2	200	299	4.03e-11	SMART
FerI	282	353	2.76e-37	SMART
C2	359	473	2.93e-13	SMART
low complexity region	532	543	N/A	INTRINSIC
FerA	663	728	5.07e-27	SMART
FerB	755	829	2.39e-46	SMART
DysFN	843	901	6.42e-21	SMART
DysFN	914	970	1.16e-18	SMART
DysFC	979	1017	1.04e-11	SMART
DysFC	1037	1070	1.62e-8	SMART
C2	1127	1234	5.03e-12	SMART
C2	1289	1396	1.15e1	SMART
low complexity region	1425	1436	N/A	INTRINSIC
low complexity region	1515	1526	N/A	INTRINSIC
C2	1541	1640	2.66e-11	SMART
C2	1776	1905	2.81e-1	SMART
Pfam:Ferlin_C	1939	2043	2.4e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172095
AA Change: E1958G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: E1958G

Domain	Start	End	E-Value	Type
C2	1	100	7.56e-16	SMART
low complexity region	142	159	N/A	INTRINSIC
C2	200	299	4.03e-11	SMART
FerI	282	353	2.76e-37	SMART
C2	359	473	2.93e-13	SMART
low complexity region	532	543	N/A	INTRINSIC
FerA	663	728	5.07e-27	SMART
FerB	755	829	2.39e-46	SMART
DysFN	843	901	6.42e-21	SMART
DysFN	914	970	1.16e-18	SMART
DysFC	979	1017	1.04e-11	SMART
DysFC	1037	1070	1.62e-8	SMART
C2	1127	1234	5.03e-12	SMART
C2	1289	1396	1.15e1	SMART
low complexity region	1515	1526	N/A	INTRINSIC
C2	1541	1640	2.66e-11	SMART
C2	1776	1905	2.81e-1	SMART
transmembrane domain	2013	2035	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224560

Predicted Effect

unknown
Transcript: ENSMUST00000224900
AA Change: E23G

Predicted Effect

probably damaging
Transcript: ENSMUST00000225159
AA Change: E1217G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225287

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225435

Predicted Effect

probably damaging
Transcript: ENSMUST00000226068
AA Change: E1971G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Ablim1	C	A	19: 57,134,633	C173F	probably damaging	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
AI481877	T	C	4: 59,064,457	T826A	possibly damaging	Het
Arap3	T	C	18: 37,978,432	T1144A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Atm	A	C	9: 53,457,489	N2337K	probably benign	Het
Cog7	T	C	7: 121,955,992	E316G	probably damaging	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ift80	T	A	3: 68,940,198	N322Y	probably damaging	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kcnma1	T	C	14: 23,367,642	T713A	probably damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Klhl14	C	A	18: 21,652,193	R59L	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Paip1	A	G	13: 119,457,017	D189G	probably damaging	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tktl2	A	G	8: 66,513,038	N416S	probably damaging	Het
Tm7sf3	T	A	6: 146,603,977	I494F	possibly damaging	Het
Trf	C	T	9: 103,226,108	V119M	probably damaging	Het

Other mutations in Myof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Myof	APN	19	37960934	missense	probably benign	0.16
IGL00764:Myof	APN	19	37974923	missense	probably benign	0.04
IGL00801:Myof	APN	19	37986073	missense	probably damaging	0.99
IGL01084:Myof	APN	19	37936436	missense	probably damaging	1.00
IGL01368:Myof	APN	19	37936457	missense	probably damaging	0.97
IGL01472:Myof	APN	19	37923076	missense	probably benign
IGL01785:Myof	APN	19	37980423	nonsense	probably null
IGL02205:Myof	APN	19	37924635	missense	probably damaging	1.00
IGL02268:Myof	APN	19	37954429	missense	possibly damaging	0.50
IGL02268:Myof	APN	19	37974863	missense	possibly damaging	0.90
IGL02339:Myof	APN	19	37972213	missense	possibly damaging	0.46
IGL02433:Myof	APN	19	37972193	missense	probably benign	0.05
IGL02481:Myof	APN	19	37937913	nonsense	probably null
IGL02536:Myof	APN	19	37949655	missense	probably damaging	0.97
IGL02682:Myof	APN	19	37921481	missense	probably benign	0.09
IGL02732:Myof	APN	19	37977716	missense	possibly damaging	0.50
IGL02887:Myof	APN	19	37920779	critical splice acceptor site	probably null
IGL03114:Myof	APN	19	37903861	missense	probably damaging	1.00
IGL03137:Myof	APN	19	37974889	missense	probably damaging	1.00
IGL03340:Myof	APN	19	37911159	missense	probably damaging	1.00
PIT4791001:Myof	UTSW	19	37982958	critical splice donor site	probably null
R0024:Myof	UTSW	19	37915740	missense	probably damaging	0.98
R0140:Myof	UTSW	19	37951556	nonsense	probably null
R0309:Myof	UTSW	19	37981266	missense	probably benign	0.12
R0330:Myof	UTSW	19	37935878	missense	probably damaging	1.00
R0345:Myof	UTSW	19	38024345	missense	probably damaging	1.00
R0349:Myof	UTSW	19	37910969	missense	probably damaging	0.99
R0463:Myof	UTSW	19	37916504	missense	probably damaging	1.00
R0507:Myof	UTSW	19	37901277	missense	possibly damaging	0.94
R0512:Myof	UTSW	19	37954524	missense	possibly damaging	0.54
R0608:Myof	UTSW	19	37916504	missense	probably damaging	1.00
R0723:Myof	UTSW	19	37981260	missense	probably damaging	1.00
R1081:Myof	UTSW	19	37986088	missense	probably damaging	0.99
R1196:Myof	UTSW	19	37910960	missense	probably damaging	1.00
R1243:Myof	UTSW	19	37936092	missense	probably damaging	1.00
R1371:Myof	UTSW	19	37903668	splice site	probably benign
R1381:Myof	UTSW	19	37995485	missense	probably damaging	1.00
R1527:Myof	UTSW	19	37924619	missense	probably damaging	1.00
R1672:Myof	UTSW	19	37943479	missense	probably damaging	1.00
R1864:Myof	UTSW	19	37986705	missense	probably benign
R1914:Myof	UTSW	19	37977693	missense	probably damaging	1.00
R1915:Myof	UTSW	19	37977693	missense	probably damaging	1.00
R1970:Myof	UTSW	19	37945634	missense	probably damaging	0.99
R2062:Myof	UTSW	19	37915746	missense	possibly damaging	0.94
R2144:Myof	UTSW	19	37981221	critical splice donor site	probably null
R2243:Myof	UTSW	19	37901319	missense	probably damaging	1.00
R2339:Myof	UTSW	19	37937927	missense	probably damaging	1.00
R2484:Myof	UTSW	19	37903843	missense	probably benign	0.13
R2880:Myof	UTSW	19	37923025	missense	probably benign	0.04
R3418:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R3967:Myof	UTSW	19	37901263	missense	probably damaging	1.00
R3967:Myof	UTSW	19	38022610	missense	possibly damaging	0.59
R3970:Myof	UTSW	19	37901263	missense	probably damaging	1.00
R3970:Myof	UTSW	19	38022610	missense	possibly damaging	0.59
R4238:Myof	UTSW	19	37923008	nonsense	probably null
R4405:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R4406:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R4407:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R4408:Myof	UTSW	19	37922978	missense	probably damaging	0.97
R4561:Myof	UTSW	19	37922990	missense	probably benign
R4606:Myof	UTSW	19	37967099	missense	probably damaging	1.00
R4778:Myof	UTSW	19	37949563	missense	probably damaging	1.00
R4801:Myof	UTSW	19	37945738	missense	probably benign	0.24
R4802:Myof	UTSW	19	37945738	missense	probably benign	0.24
R4812:Myof	UTSW	19	37916559	missense	probably damaging	1.00
R4884:Myof	UTSW	19	37942357	missense	probably damaging	1.00
R4964:Myof	UTSW	19	37935852	missense	probably damaging	0.97
R4966:Myof	UTSW	19	37935852	missense	probably damaging	0.97
R5069:Myof	UTSW	19	37905325	missense	possibly damaging	0.65
R5181:Myof	UTSW	19	37932623	missense	possibly damaging	0.95
R5376:Myof	UTSW	19	37916400	missense	probably damaging	1.00
R5384:Myof	UTSW	19	37952987	missense	probably damaging	0.98
R5543:Myof	UTSW	19	37981330	missense	probably benign	0.00
R5626:Myof	UTSW	19	37922990	missense	probably benign
R5865:Myof	UTSW	19	37910934	missense	probably damaging	1.00
R5919:Myof	UTSW	19	38024370	missense	possibly damaging	0.95
R5924:Myof	UTSW	19	37982973	missense	probably damaging	0.97
R5997:Myof	UTSW	19	37905299	missense	possibly damaging	0.90
R5999:Myof	UTSW	19	37939856	nonsense	probably null
R6039:Myof	UTSW	19	37977684	missense	probably damaging	1.00
R6039:Myof	UTSW	19	37977684	missense	probably damaging	1.00
R6041:Myof	UTSW	19	37924620	missense	probably damaging	1.00
R6051:Myof	UTSW	19	38024361	missense	probably damaging	1.00
R6057:Myof	UTSW	19	37926981	critical splice donor site	probably null
R6089:Myof	UTSW	19	37967060	missense	probably benign	0.37
R6195:Myof	UTSW	19	37913357	missense	possibly damaging	0.89
R6478:Myof	UTSW	19	37903831	missense	probably damaging	1.00
R6545:Myof	UTSW	19	37942297	missense	possibly damaging	0.67
R6655:Myof	UTSW	19	37934791	missense	probably damaging	1.00
R6715:Myof	UTSW	19	37968346	missense	probably benign	0.04
R6737:Myof	UTSW	19	37943514	missense	probably benign	0.01
R6837:Myof	UTSW	19	37922956	critical splice donor site	probably null
R7096:Myof	UTSW	19	37936200	missense	probably damaging	1.00
R7308:Myof	UTSW	19	37910911	missense	probably damaging	0.98
R7328:Myof	UTSW	19	37916399	missense	probably damaging	1.00
R7485:Myof	UTSW	19	37951491	nonsense	probably null
R7554:Myof	UTSW	19	37954510	missense	probably benign	0.09
R7759:Myof	UTSW	19	37939898	missense	probably benign	0.00
R7779:Myof	UTSW	19	37939390	missense	probably damaging	1.00
R8116:Myof	UTSW	19	37932719	missense	probably damaging	0.99
R8264:Myof	UTSW	19	37921433	missense	probably damaging	1.00
R8415:Myof	UTSW	19	37995424	missense	probably benign
R8756:Myof	UTSW	19	37939952	missense	probably benign
R8777:Myof	UTSW	19	37980393	missense	probably benign	0.01
R8777-TAIL:Myof	UTSW	19	37980393	missense	probably benign	0.01
R8835:Myof	UTSW	19	37967099	missense	possibly damaging	0.92
R9046:Myof	UTSW	19	37934664	intron	probably benign
R9396:Myof	UTSW	19	37934846	missense	probably damaging	1.00
R9415:Myof	UTSW	19	37952964	missense	probably damaging	1.00
R9450:Myof	UTSW	19	37960926	missense	probably damaging	1.00
R9451:Myof	UTSW	19	37977648	critical splice donor site	probably null
R9537:Myof	UTSW	19	37907606	missense	probably damaging	1.00
R9592:Myof	UTSW	19	38043289	missense	probably damaging	0.99
R9616:Myof	UTSW	19	37934815	missense	possibly damaging	0.52
R9751:Myof	UTSW	19	37936370	missense	probably benign
X0024:Myof	UTSW	19	37974597	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- GCCAAAGCCTGGTTTAATGGGGAAG -3'
(R):5'- TGCTCACTGATGCAGCTAAGGCAC -3'

Sequencing Primer
(F):5'- TTAGAGGGCCAATAATCCAGC -3'
(R):5'- AGAAACATGGTTCCATCTCTCGG -3'

Posted On

2014-03-14