Incidental Mutation 'R1503:Pcdhb8'
ID169499
Institutional Source Beutler Lab
Gene Symbol Pcdhb8
Ensembl Gene ENSMUSG00000045876
Gene Nameprotocadherin beta 8
SynonymsPcdhb5C, PcdhbH
MMRRC Submission 039553-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1503 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37355121-37358604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37356519 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 76 (N76Y)
Ref Sequence ENSEMBL: ENSMUSP00000141814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051163] [ENSMUST00000115661] [ENSMUST00000192867] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000051163
AA Change: N417Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054371
Gene: ENSMUSG00000045876
AA Change: N417Y

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 6.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 9.51e-26 SMART
CA 588 669 5.65e-10 SMART
Pfam:Cadherin_C_2 685 768 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192867
AA Change: N76Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141814
Gene: ENSMUSG00000045876
AA Change: N76Y

DomainStartEndE-ValueType
CA 26 104 7e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Atf7ip G T 6: 136,606,867 V1299L probably damaging Het
Atp12a A T 14: 56,373,424 N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 G439D probably damaging Het
Bpifb2 G A 2: 153,889,510 D269N possibly damaging Het
Btd T G 14: 31,667,655 C444W probably damaging Het
Cacna1a A G 8: 84,601,946 D1624G probably benign Het
Carmil3 A C 14: 55,498,280 N563T probably damaging Het
Cars T C 7: 143,568,989 R538G probably benign Het
Catsperd A G 17: 56,654,525 K416E possibly damaging Het
Cc2d2a A T 5: 43,695,239 Y386F probably damaging Het
Ccpg1 A G 9: 72,999,478 N66S probably benign Het
Cd48 T A 1: 171,695,847 L86H probably damaging Het
Cdan1 A T 2: 120,729,575 H369Q probably damaging Het
Chil4 T C 3: 106,206,034 D189G probably benign Het
Cit T A 5: 115,873,900 Y189N possibly damaging Het
Cntn3 G A 6: 102,464,565 Q7* probably null Het
Csn1s2a A T 5: 87,775,799 I5F possibly damaging Het
Ctnnd1 C T 2: 84,605,179 probably null Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Dnah12 T C 14: 26,773,692 S1426P probably damaging Het
Dnhd1 T G 7: 105,693,660 S1404A possibly damaging Het
Drosha T A 15: 12,848,073 C484S probably benign Het
Dsg4 A T 18: 20,449,679 I125F probably damaging Het
Egfr T A 11: 16,869,301 M277K possibly damaging Het
Eml5 G T 12: 98,831,174 L1059I probably damaging Het
Erbb4 G T 1: 68,346,546 H295N probably benign Het
Etl4 T G 2: 20,743,874 V139G possibly damaging Het
Fam160a1 T A 3: 85,672,477 Y807F possibly damaging Het
Frem3 A T 8: 80,687,018 E1969D probably damaging Het
Gdf3 T A 6: 122,606,337 D357V probably damaging Het
Gimap8 T A 6: 48,647,529 probably null Het
Gml2 C A 15: 74,821,352 S68* probably null Het
Gphn A G 12: 78,504,629 I248V possibly damaging Het
Greb1 A T 12: 16,724,819 Y192* probably null Het
Hmbs A C 9: 44,337,432 L215W probably benign Het
Iglon5 T A 7: 43,479,025 T123S probably benign Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Ints8 A T 4: 11,245,842 L212Q probably damaging Het
Itgad A G 7: 128,198,121 Y846C probably benign Het
Kcnj1 A G 9: 32,396,492 T51A probably damaging Het
Kif1bp A G 10: 62,559,408 V485A probably damaging Het
Kif9 A T 9: 110,510,438 K449N possibly damaging Het
Klk11 G A 7: 43,778,909 W241* probably null Het
Krt32 T C 11: 100,084,110 probably null Het
Loxl1 A G 9: 58,293,640 F513S probably damaging Het
Mapk8ip3 A T 17: 24,904,923 S571T probably damaging Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mtss1 T C 15: 58,951,672 N282S probably damaging Het
Myh13 T A 11: 67,353,674 D1012E probably benign Het
Myo16 A G 8: 10,502,817 T952A probably benign Het
Neb T C 2: 52,298,620 D874G probably damaging Het
Nek11 A G 9: 105,163,204 Y553H probably damaging Het
Nr2c2 T A 6: 92,105,331 V9D probably benign Het
Nxf1 T A 19: 8,762,436 F51L probably benign Het
Olfr1260 T C 2: 89,978,528 V250A probably damaging Het
Olfr1347 T C 7: 6,488,179 I232V probably damaging Het
Olfr1350 A G 7: 6,570,471 N160S probably damaging Het
Olfr170 A G 16: 19,606,312 S119P probably benign Het
Olfr344 A T 2: 36,568,873 I92F probably damaging Het
Olfr397 T G 11: 73,964,568 probably null Het
Olfr750 A G 14: 51,070,734 S220P probably damaging Het
Pdzrn4 T A 15: 92,399,804 F217I probably damaging Het
Ppp1r16a T A 15: 76,694,399 H434Q probably benign Het
Prpf19 T A 19: 10,901,022 F291I possibly damaging Het
R3hdm2 G T 10: 127,471,826 E319* probably null Het
Sel1l3 A G 5: 53,137,929 Y777H probably damaging Het
Serpinb5 G A 1: 106,870,289 A3T possibly damaging Het
Skp2 C A 15: 9,127,911 V88F probably damaging Het
Slc25a16 T C 10: 62,928,376 Y71H probably damaging Het
Slc6a6 T A 6: 91,740,992 I304N probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox17 C A 1: 4,491,928 G222C probably damaging Het
Trmu T A 15: 85,895,019 V289E possibly damaging Het
Vdac2 A G 14: 21,837,877 E96G probably damaging Het
Wdhd1 A T 14: 47,247,400 D885E probably benign Het
Zfp646 A G 7: 127,880,136 N495S probably damaging Het
Zfp663 T C 2: 165,352,653 T549A probably damaging Het
Zfp935 G A 13: 62,455,137 A83V possibly damaging Het
Other mutations in Pcdhb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Pcdhb8 APN 18 37355473 missense probably benign 0.00
IGL00574:Pcdhb8 APN 18 37356370 missense probably damaging 1.00
IGL00960:Pcdhb8 APN 18 37355973 missense probably benign 0.28
IGL01103:Pcdhb8 APN 18 37357200 missense probably damaging 1.00
IGL01330:Pcdhb8 APN 18 37357578 missense probably benign 0.12
IGL01413:Pcdhb8 APN 18 37355976 missense probably damaging 1.00
IGL01418:Pcdhb8 APN 18 37355976 missense probably damaging 1.00
IGL01608:Pcdhb8 APN 18 37356925 missense probably damaging 1.00
IGL02212:Pcdhb8 APN 18 37356412 missense possibly damaging 0.95
IGL02582:Pcdhb8 APN 18 37355374 missense possibly damaging 0.79
IGL02607:Pcdhb8 APN 18 37357581 missense probably benign 0.00
IGL02882:Pcdhb8 APN 18 37356223 missense possibly damaging 0.95
IGL03005:Pcdhb8 APN 18 37357534 missense probably damaging 1.00
IGL03108:Pcdhb8 APN 18 37357246 missense probably damaging 1.00
PIT4468001:Pcdhb8 UTSW 18 37356633 missense probably damaging 1.00
R0104:Pcdhb8 UTSW 18 37355665 missense probably benign 0.01
R0490:Pcdhb8 UTSW 18 37356780 missense probably damaging 1.00
R0617:Pcdhb8 UTSW 18 37357047 missense probably benign 0.02
R1168:Pcdhb8 UTSW 18 37356727 missense probably benign
R1189:Pcdhb8 UTSW 18 37356567 nonsense probably null
R1232:Pcdhb8 UTSW 18 37355775 missense probably benign 0.28
R1576:Pcdhb8 UTSW 18 37356703 missense probably damaging 1.00
R1731:Pcdhb8 UTSW 18 37355838 missense probably damaging 1.00
R1908:Pcdhb8 UTSW 18 37355962 missense possibly damaging 0.84
R1909:Pcdhb8 UTSW 18 37355962 missense possibly damaging 0.84
R2215:Pcdhb8 UTSW 18 37357074 missense probably damaging 0.98
R3080:Pcdhb8 UTSW 18 37356166 missense probably damaging 1.00
R4394:Pcdhb8 UTSW 18 37356882 missense probably damaging 1.00
R4799:Pcdhb8 UTSW 18 37355653 missense probably damaging 1.00
R4845:Pcdhb8 UTSW 18 37356718 missense probably benign 0.43
R4879:Pcdhb8 UTSW 18 37356166 missense probably damaging 1.00
R4941:Pcdhb8 UTSW 18 37356006 missense probably benign 0.03
R5086:Pcdhb8 UTSW 18 37356106 missense probably damaging 1.00
R5416:Pcdhb8 UTSW 18 37356955 missense probably damaging 1.00
R5774:Pcdhb8 UTSW 18 37356685 missense probably damaging 1.00
R5898:Pcdhb8 UTSW 18 37357484 missense possibly damaging 0.92
R5935:Pcdhb8 UTSW 18 37356190 missense probably damaging 1.00
R6191:Pcdhb8 UTSW 18 37356226 missense probably benign
R6228:Pcdhb8 UTSW 18 37356984 missense probably benign 0.05
R6245:Pcdhb8 UTSW 18 37357169 missense possibly damaging 0.80
R6397:Pcdhb8 UTSW 18 37355463 nonsense probably null
R7469:Pcdhb8 UTSW 18 37355958 missense probably damaging 1.00
R7632:Pcdhb8 UTSW 18 37355595 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATGTGAACGACAATGCCCC -3'
(R):5'- TCTGAGTTGATGGAGATCAGCGAGG -3'

Sequencing Primer
(F):5'- TAGTTCCATCCCAGAAAATGCTC -3'
(R):5'- CATTGGAGCCAGAGTCTGAGTC -3'
Posted On2014-04-13