Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Carmil3'

169484

Institutional Source

Beutler Lab

Gene Symbol

Carmil3

Ensembl Gene

ENSMUSG00000022211

Gene Name

capping protein regulator and myosin 1 linker 3

Synonyms

Lrrc16b

MMRRC Submission

039553-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.199) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55490651-55508272 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 55498280 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 563 (N563T)

Ref Sequence

ENSEMBL: ENSMUSP00000075587 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076236] [ENSMUST00000226757] [ENSMUST00000228877]

AlphaFold

Q3UFQ8

Predicted Effect

probably damaging
Transcript: ENSMUST00000076236
AA Change: N563T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000075587
Gene: ENSMUSG00000022211
AA Change: N563T

Domain	Start	End	E-Value	Type
low complexity region	138	151	N/A	INTRINSIC
internal_repeat_1	203	297	7.56e-6	PROSPERO
Blast:LRR	333	362	5e-10	BLAST
Blast:LRR	423	446	1e-5	BLAST
low complexity region	447	462	N/A	INTRINSIC
low complexity region	468	479	N/A	INTRINSIC
internal_repeat_1	496	593	7.56e-6	PROSPERO
Pfam:CARMIL_C	778	1065	5.3e-76	PFAM
low complexity region	1068	1117	N/A	INTRINSIC
low complexity region	1137	1146	N/A	INTRINSIC
low complexity region	1204	1216	N/A	INTRINSIC
low complexity region	1318	1329	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226388

Predicted Effect

probably benign
Transcript: ENSMUST00000226446

Predicted Effect

probably benign
Transcript: ENSMUST00000226757

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227070

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227088

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227312

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227563

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228760

Predicted Effect

probably benign
Transcript: ENSMUST00000228877

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Carmil3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Carmil3	APN	14	55498298	missense	probably damaging	0.99
IGL00498:Carmil3	APN	14	55501895	critical splice donor site	probably null
IGL01061:Carmil3	APN	14	55498630	missense	possibly damaging	0.67
IGL01452:Carmil3	APN	14	55496058	missense	probably damaging	0.99
IGL01606:Carmil3	APN	14	55493849	missense	possibly damaging	0.83
IGL01633:Carmil3	APN	14	55494227	missense	possibly damaging	0.84
IGL01977:Carmil3	APN	14	55493536	missense	probably damaging	1.00
IGL02065:Carmil3	APN	14	55493822	splice site	probably benign
IGL02160:Carmil3	APN	14	55493558	missense	possibly damaging	0.70
IGL02491:Carmil3	APN	14	55504517	missense	probably benign	0.00
IGL02567:Carmil3	APN	14	55498882	missense	possibly damaging	0.93
IGL02629:Carmil3	APN	14	55499068	missense	probably damaging	0.97
IGL02720:Carmil3	APN	14	55507410	missense	probably damaging	0.97
IGL03100:Carmil3	APN	14	55494718	missense	probably damaging	0.99
PIT4434001:Carmil3	UTSW	14	55494688	missense	probably null	1.00
R0023:Carmil3	UTSW	14	55492876	missense	probably damaging	1.00
R0023:Carmil3	UTSW	14	55492876	missense	probably damaging	1.00
R0027:Carmil3	UTSW	14	55494403	missense	probably damaging	0.96
R0101:Carmil3	UTSW	14	55497755	splice site	probably benign
R0321:Carmil3	UTSW	14	55502241	missense	possibly damaging	0.63
R0370:Carmil3	UTSW	14	55495442	missense	possibly damaging	0.82
R0465:Carmil3	UTSW	14	55499861	missense	probably damaging	0.99
R0647:Carmil3	UTSW	14	55502435	critical splice donor site	probably null
R1635:Carmil3	UTSW	14	55496282	missense	possibly damaging	0.91
R1715:Carmil3	UTSW	14	55504532	missense	probably benign	0.02
R1923:Carmil3	UTSW	14	55502404	missense	probably damaging	0.99
R1944:Carmil3	UTSW	14	55498630	missense	probably damaging	0.97
R2513:Carmil3	UTSW	14	55503838	missense	probably damaging	0.98
R2892:Carmil3	UTSW	14	55498313	missense	probably damaging	0.96
R3433:Carmil3	UTSW	14	55507694	missense	probably benign	0.05
R3552:Carmil3	UTSW	14	55507402	missense	possibly damaging	0.86
R3783:Carmil3	UTSW	14	55496976	missense	probably damaging	1.00
R3787:Carmil3	UTSW	14	55496976	missense	probably damaging	1.00
R4181:Carmil3	UTSW	14	55503955	missense	probably benign	0.10
R4285:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4420:Carmil3	UTSW	14	55493588	missense	probably damaging	0.98
R4424:Carmil3	UTSW	14	55501471	missense	probably benign
R4506:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4507:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4534:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4535:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4549:Carmil3	UTSW	14	55505664	splice site	probably null
R4574:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4783:Carmil3	UTSW	14	55501321	critical splice donor site	probably null
R4784:Carmil3	UTSW	14	55501321	critical splice donor site	probably null
R5146:Carmil3	UTSW	14	55497179	missense	probably benign	0.02
R5279:Carmil3	UTSW	14	55501571	missense	probably damaging	0.98
R5425:Carmil3	UTSW	14	55493877	missense	probably benign	0.41
R5530:Carmil3	UTSW	14	55493624	missense	probably damaging	0.98
R5534:Carmil3	UTSW	14	55494890	missense	probably damaging	0.97
R5598:Carmil3	UTSW	14	55503999	frame shift	probably null
R5772:Carmil3	UTSW	14	55493239	missense	probably damaging	1.00
R5896:Carmil3	UTSW	14	55503999	frame shift	probably null
R5931:Carmil3	UTSW	14	55498940	missense	probably damaging	0.99
R6048:Carmil3	UTSW	14	55503845	missense	probably benign	0.00
R6103:Carmil3	UTSW	14	55505427	missense	probably benign	0.02
R6258:Carmil3	UTSW	14	55500432	missense	probably damaging	1.00
R6260:Carmil3	UTSW	14	55500432	missense	probably damaging	1.00
R6338:Carmil3	UTSW	14	55499849	missense	possibly damaging	0.83
R6339:Carmil3	UTSW	14	55499849	missense	possibly damaging	0.83
R6646:Carmil3	UTSW	14	55507930	missense	probably damaging	0.97
R6936:Carmil3	UTSW	14	55501561	missense	probably benign	0.04
R7164:Carmil3	UTSW	14	55501282	missense	probably damaging	0.98
R7214:Carmil3	UTSW	14	55498612	missense	probably damaging	1.00
R7223:Carmil3	UTSW	14	55496238	missense	possibly damaging	0.48
R7269:Carmil3	UTSW	14	55493895	missense	probably benign	0.03
R7319:Carmil3	UTSW	14	55494360	missense	probably benign	0.13
R7357:Carmil3	UTSW	14	55491133	start gained	probably benign
R7386:Carmil3	UTSW	14	55497747	critical splice donor site	probably null
R7463:Carmil3	UTSW	14	55502396	missense	probably damaging	1.00
R7598:Carmil3	UTSW	14	55494821	missense	possibly damaging	0.61
R7602:Carmil3	UTSW	14	55501508	missense	probably null	0.00
R7617:Carmil3	UTSW	14	55497891	missense	probably benign	0.06
R7985:Carmil3	UTSW	14	55496952	missense	probably benign	0.03
R8127:Carmil3	UTSW	14	55498244	missense	probably damaging	0.98
R8423:Carmil3	UTSW	14	55499065	missense	probably damaging	1.00
R8465:Carmil3	UTSW	14	55496848	missense	probably damaging	1.00
R8849:Carmil3	UTSW	14	55497170	missense	probably benign	0.01
R8955:Carmil3	UTSW	14	55496077	missense	probably damaging	0.98
R9321:Carmil3	UTSW	14	55503968	missense
R9346:Carmil3	UTSW	14	55494684	missense	probably damaging	1.00
R9387:Carmil3	UTSW	14	55494412	nonsense	probably null
R9578:Carmil3	UTSW	14	55503836	critical splice acceptor site	probably null
U24488:Carmil3	UTSW	14	55497179	missense	probably benign	0.02
Z1088:Carmil3	UTSW	14	55501568	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGGACTGTGTGAGTGACCTAGC -3'
(R):5'- GGTGTGACCTTCTTTGAGCAACCC -3'

Sequencing Primer
(F):5'- TATGGGGACCCACCCTAAC -3'
(R):5'- AGCCGACTCAGACATGGTTC -3'

Posted On

2014-04-13