Incidental Mutation 'R1734:Map3k10'
ID199567
Institutional Source Beutler Lab
Gene Symbol Map3k10
Ensembl Gene ENSMUSG00000040390
Gene Namemitogen-activated protein kinase kinase kinase 10
SynonymsMlk2, serine/threonine kinase, MKN28 derived nonreceptor_type, mixed lineage kinase 2, MKN28 kinase
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1734 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27656375-27674598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27658115 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 746 (D746G)
Ref Sequence ENSEMBL: ENSMUSP00000103978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008088] [ENSMUST00000036453] [ENSMUST00000108341]
Predicted Effect probably benign
Transcript: ENSMUST00000008088
SMART Domains Protein: ENSMUSP00000008088
Gene: ENSMUSG00000007944

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
low complexity region 49 65 N/A INTRINSIC
Blast:TPR 66 95 2e-7 BLAST
low complexity region 101 117 N/A INTRINSIC
Blast:TPR 133 168 1e-10 BLAST
Pfam:TPR_2 169 202 3.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036453
AA Change: D746G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037725
Gene: ENSMUSG00000040390
AA Change: D746G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
SH3 19 80 6e-20 SMART
Pfam:Pkinase 98 357 7.4e-59 PFAM
Pfam:Pkinase_Tyr 98 357 3.8e-62 PFAM
coiled coil region 378 449 N/A INTRINSIC
low complexity region 501 511 N/A INTRINSIC
low complexity region 524 550 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
low complexity region 761 778 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108341
AA Change: D746G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103978
Gene: ENSMUSG00000040390
AA Change: D746G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
SH3 19 80 6e-20 SMART
Pfam:Pkinase_Tyr 98 357 2e-62 PFAM
Pfam:Pkinase 98 358 4.8e-59 PFAM
coiled coil region 378 449 N/A INTRINSIC
low complexity region 501 511 N/A INTRINSIC
low complexity region 524 550 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
low complexity region 761 778 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
Meta Mutation Damage Score 0.1240 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase has been shown to activate MAPK8/JNK and MKK4/SEK1, and this kinase itself can be phoshorylated, and thus activated by JNK kinases. This kinase functions preferentially on the JNK signaling pathway, and is reported to be involved in nerve growth factor (NGF) induced neuronal apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit normal development, reproduction and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Map3k10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Map3k10 APN 7 27668469 missense probably damaging 1.00
IGL00672:Map3k10 APN 7 27661601 missense probably damaging 0.98
IGL00913:Map3k10 APN 7 27663215 unclassified probably benign
IGL01383:Map3k10 APN 7 27657999 missense probably benign 0.15
IGL02683:Map3k10 APN 7 27658937 missense probably damaging 1.00
R0039:Map3k10 UTSW 7 27658098 missense possibly damaging 0.95
R0219:Map3k10 UTSW 7 27656731 missense probably damaging 1.00
R0285:Map3k10 UTSW 7 27673900 missense probably benign 0.00
R0368:Map3k10 UTSW 7 27663360 missense probably damaging 0.98
R0724:Map3k10 UTSW 7 27668355 missense probably damaging 1.00
R0729:Map3k10 UTSW 7 27661567 missense probably damaging 1.00
R1847:Map3k10 UTSW 7 27661556 splice site probably null
R2395:Map3k10 UTSW 7 27673993 missense unknown
R2517:Map3k10 UTSW 7 27663263 missense possibly damaging 0.92
R3841:Map3k10 UTSW 7 27658364 missense possibly damaging 0.91
R4749:Map3k10 UTSW 7 27658361 missense possibly damaging 0.78
R5269:Map3k10 UTSW 7 27658532 missense probably benign 0.01
R5822:Map3k10 UTSW 7 27656734 missense probably damaging 1.00
R6059:Map3k10 UTSW 7 27656822 missense probably damaging 0.99
R6417:Map3k10 UTSW 7 27663284 missense probably damaging 1.00
R6420:Map3k10 UTSW 7 27663284 missense probably damaging 1.00
R7903:Map3k10 UTSW 7 27657957 missense probably damaging 0.99
R8118:Map3k10 UTSW 7 27673417 missense possibly damaging 0.91
R8191:Map3k10 UTSW 7 27663246 missense probably damaging 0.99
R8336:Map3k10 UTSW 7 27673459 missense probably benign 0.25
X0020:Map3k10 UTSW 7 27664462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGATTGCTTGGACAGGCCCCAC -3'
(R):5'- TCCCATTGCAGAAGAATTTGCGGAG -3'

Sequencing Primer
(F):5'- AGGCTCCCGTTGTCTCAAAG -3'
(R):5'- TAAGCTGTGCCACGCTG -3'
Posted On2014-05-23