Mutagenetix > Incidental Mutation

Incidental Mutation 'R2020:Sec24b'

223783

Institutional Source

Beutler Lab

Gene Symbol

Sec24b

Ensembl Gene

ENSMUSG00000001052

Gene Name

Sec24 related gene family, member B (S. cerevisiae)

Synonyms

SEC24

MMRRC Submission

040029-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.662) question?

Stock #

R2020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129982759-130061553 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 129987728 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1166 (V1166M)

Ref Sequence

ENSEMBL: ENSMUSP00000001079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001079] [ENSMUST00000165873]

AlphaFold

Q80ZX0

Predicted Effect

probably damaging
Transcript: ENSMUST00000001079
AA Change: V1166M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000001079
Gene: ENSMUSG00000001052
AA Change: V1166M

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
low complexity region	127	143	N/A	INTRINSIC
low complexity region	229	254	N/A	INTRINSIC
low complexity region	316	333	N/A	INTRINSIC
low complexity region	351	362	N/A	INTRINSIC
low complexity region	363	373	N/A	INTRINSIC
low complexity region	378	386	N/A	INTRINSIC
low complexity region	419	444	N/A	INTRINSIC
low complexity region	450	473	N/A	INTRINSIC
low complexity region	486	505	N/A	INTRINSIC
low complexity region	555	568	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	585	622	4.1e-17	PFAM
Pfam:Sec23_trunk	658	897	2.4e-87	PFAM
Pfam:Sec23_BS	902	986	3.4e-23	PFAM
Pfam:Sec23_helical	999	1099	8.7e-31	PFAM
Pfam:Gelsolin	1122	1197	4.9e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164758

Predicted Effect

probably benign
Transcript: ENSMUST00000165873

SMART Domains

Protein: ENSMUSP00000132861
Gene: ENSMUSG00000001052

Domain	Start	End	E-Value	Type
low complexity region	1	26	N/A	INTRINSIC
low complexity region	88	105	N/A	INTRINSIC
low complexity region	115	123	N/A	INTRINSIC
low complexity region	156	181	N/A	INTRINSIC
low complexity region	187	210	N/A	INTRINSIC
low complexity region	223	242	N/A	INTRINSIC
low complexity region	292	305	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	321	359	2.5e-18	PFAM
Pfam:Sec23_trunk	395	634	1.6e-87	PFAM
Pfam:Sec23_BS	639	723	2.2e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170163

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172324

Meta Mutation Damage Score

0.2099

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein is thought to be a cargo-binding component of the COPII vesicle, and is thought to be involved in the transport of secretory proteins from the endoplasmic reticulum to the Golgi apparatus. Mutations in this gene have been associated with neural tube defects, and are thought to be a result of a disruption in interactions with the protein encoded by the VANGL planar cell polarity protein 2 (VANGL2) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit craniorachischisis, abnormal embryo shape, omphalocele, disoriented hair cells, and failure of eyelid fusion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332		probably null	Het
Akap9	T	C	5: 3,961,967	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269		probably null	Het
Ccdc27	T	C	4: 154,033,313	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445		probably benign	Het
Chd7	G	A	4: 8,855,226	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181		probably benign	Het
Col20a1	G	A	2: 181,013,163		probably null	Het
Cped1	A	G	6: 22,143,964	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003	F131L	probably damaging	Het
Dhx38	G	A	8: 109,556,869		probably benign	Het
Dido1	G	T	2: 180,659,585	N2175K	unknown	Het
Dmxl1	T	A	18: 49,889,558	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101	H1658L	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Dync2h1	T	C	9: 7,162,925	I555V	probably benign	Het
Eif2ak2	T	C	17: 78,863,963	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149	D46V	probably benign	Het
Fech	C	T	18: 64,478,727	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896	M884T	probably benign	Het
Gtf2ird1	T	C	5: 134,417,093	D28G	probably damaging	Het
Gtf3c4	C	A	2: 28,833,894	G468W	possibly damaging	Het
Ift172	A	T	5: 31,267,241	L201*	probably null	Het
Il1rl2	C	A	1: 40,365,214	S498R	probably damaging	Het
Ildr1	C	T	16: 36,725,541	R489W	probably damaging	Het
Itga10	G	A	3: 96,652,490	G487D	probably damaging	Het
Klk8	A	G	7: 43,799,216	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223		probably null	Het
Nlgn2	G	T	11: 69,828,441	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312	V868M	probably damaging	Het
Prkcq	G	A	2: 11,279,521	V501I	probably benign	Het
Prom1	T	A	5: 44,011,253		probably benign	Het
Ptprd	A	G	4: 76,133,161	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398	G189E	possibly damaging	Het
Ret	T	C	6: 118,180,382	K236E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057		probably null	Het
Rnf213	A	G	11: 119,461,918	T3916A	probably damaging	Het
Rpn1	A	G	6: 88,095,683	N336S	probably damaging	Het
Sag	G	A	1: 87,805,315	A2T	probably damaging	Het
Sco2	T	C	15: 89,371,860	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944	I183T	possibly damaging	Het
Slc27a5	A	T	7: 12,993,412	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107		probably null	Het
Stx18	A	G	5: 38,135,244	H230R	probably damaging	Het
Tas2r130	A	T	6: 131,630,769	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819	T395S	probably damaging	Het
Tsc22d1	T	C	14: 76,418,333	S751P	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024		probably benign	Het
Ugdh	T	C	5: 65,416,925	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830	G163D	unknown	Het

Other mutations in Sec24b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00984:Sec24b	APN	3	130020646	intron	probably benign
IGL01137:Sec24b	APN	3	130007444	missense	probably benign	0.02
IGL01370:Sec24b	APN	3	130007604	splice site	probably benign
IGL01931:Sec24b	APN	3	130009799	missense	probably benign	0.00
PIT4696001:Sec24b	UTSW	3	129994391	missense	probably benign	0.01
R0193:Sec24b	UTSW	3	129988984	missense	probably null
R0194:Sec24b	UTSW	3	129984165	critical splice donor site	probably null
R0403:Sec24b	UTSW	3	129989676	missense	possibly damaging	0.81
R0403:Sec24b	UTSW	3	129999534	missense	probably damaging	1.00
R0576:Sec24b	UTSW	3	130041336	missense	probably benign	0.11
R0583:Sec24b	UTSW	3	130041311	nonsense	probably null
R0963:Sec24b	UTSW	3	130040905	missense	probably benign	0.02
R0967:Sec24b	UTSW	3	129996782	missense	probably damaging	1.00
R1344:Sec24b	UTSW	3	130007423	missense	probably damaging	1.00
R1418:Sec24b	UTSW	3	130007423	missense	probably damaging	1.00
R1594:Sec24b	UTSW	3	129991351	missense	probably benign	0.00
R1716:Sec24b	UTSW	3	130041016	missense	possibly damaging	0.89
R1938:Sec24b	UTSW	3	129991361	missense	possibly damaging	0.82
R2407:Sec24b	UTSW	3	130002316	missense	probably benign	0.02
R2415:Sec24b	UTSW	3	129996080	missense	probably benign	0.00
R3121:Sec24b	UTSW	3	130002304	critical splice donor site	probably null
R3729:Sec24b	UTSW	3	130033833	missense	possibly damaging	0.95
R3731:Sec24b	UTSW	3	130033833	missense	possibly damaging	0.95
R3789:Sec24b	UTSW	3	130020627	missense	probably benign	0.00
R4229:Sec24b	UTSW	3	130040719	missense	probably benign	0.24
R4230:Sec24b	UTSW	3	130040719	missense	probably benign	0.24
R4617:Sec24b	UTSW	3	130040764	missense	possibly damaging	0.94
R4856:Sec24b	UTSW	3	129983970	missense	probably benign	0.07
R4886:Sec24b	UTSW	3	129983970	missense	probably benign	0.07
R4913:Sec24b	UTSW	3	130002379	missense	probably benign	0.07
R5510:Sec24b	UTSW	3	130040895	missense	probably damaging	1.00
R5601:Sec24b	UTSW	3	130040834	small insertion	probably benign
R6167:Sec24b	UTSW	3	129988901	missense	possibly damaging	0.88
R6314:Sec24b	UTSW	3	130007245	splice site	probably null
R6442:Sec24b	UTSW	3	129996701	missense	probably damaging	1.00
R6512:Sec24b	UTSW	3	130041297	missense	probably damaging	1.00
R6743:Sec24b	UTSW	3	130041232	missense	probably damaging	0.98
R7081:Sec24b	UTSW	3	129987742	missense	probably benign	0.00
R7179:Sec24b	UTSW	3	129988946	missense	probably damaging	1.00
R7214:Sec24b	UTSW	3	130033860	missense	probably benign	0.19
R7332:Sec24b	UTSW	3	130041393	missense	probably benign	0.10
R7414:Sec24b	UTSW	3	130009865	missense	probably benign	0.01
R7599:Sec24b	UTSW	3	130040811	small insertion	probably benign
R7774:Sec24b	UTSW	3	129984197	missense	possibly damaging	0.88
R7895:Sec24b	UTSW	3	129995949	missense	probably benign	0.13
R8146:Sec24b	UTSW	3	129995924	nonsense	probably null
R8217:Sec24b	UTSW	3	130040950	missense	possibly damaging	0.94
R8344:Sec24b	UTSW	3	130005001	missense	probably damaging	0.97
R8525:Sec24b	UTSW	3	130011818	missense	probably damaging	1.00
R8699:Sec24b	UTSW	3	130005004	missense	probably damaging	1.00
R8783:Sec24b	UTSW	3	129989693	missense	probably benign
R8929:Sec24b	UTSW	3	130009858	missense	possibly damaging	0.80
R8967:Sec24b	UTSW	3	129991435	missense	probably damaging	1.00
R9332:Sec24b	UTSW	3	130007571	missense	probably benign	0.01
R9355:Sec24b	UTSW	3	129993840	missense	possibly damaging	0.60
R9660:Sec24b	UTSW	3	129996773	missense	probably damaging	1.00
R9728:Sec24b	UTSW	3	129996773	missense	probably damaging	1.00
R9781:Sec24b	UTSW	3	129996093	missense	probably damaging	0.98
X0065:Sec24b	UTSW	3	129996355	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AATGTAAGAGGCGGGCTCAC -3'
(R):5'- GACAATGGGAGCTGCTTTTGATTC -3'

Sequencing Primer
(F):5'- GAATTCCACGGTTAAGTGTCCTTCAG -3'
(R):5'- AATGGGAGCTGCTTTTGATTCTTCTC -3'

Posted On

2014-08-25