Incidental Mutation 'R2020:Ret'
ID 223826
Institutional Source Beutler Lab
Gene Symbol Ret
Ensembl Gene ENSMUSG00000030110
Gene Name ret proto-oncogene
Synonyms c-Ret, RET9, RET51
MMRRC Submission 040029-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.765) question?
Stock # R2020 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 118151745-118197718 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118180382 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 236 (K236E)
Ref Sequence ENSEMBL: ENSMUSP00000086169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]
AlphaFold P35546
Predicted Effect possibly damaging
Transcript: ENSMUST00000032201
AA Change: K236E

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: K236E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000088790
AA Change: K236E

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110
AA Change: K236E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Meta Mutation Damage Score 0.0983 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,968,912 noncoding transcript Het
9530053A07Rik T C 7: 28,155,594 S1882P probably benign Het
Adam17 G A 12: 21,349,875 R177C probably damaging Het
Ak7 G A 12: 105,745,332 probably null Het
Akap9 T C 5: 3,961,967 V890A probably damaging Het
Alg6 A G 4: 99,738,132 N59S probably damaging Het
Alkbh5 G T 11: 60,538,549 A43S probably benign Het
Anxa2 C A 9: 69,483,817 D162E probably damaging Het
Arap1 A G 7: 101,401,518 H1136R probably benign Het
Arhgap18 A G 10: 26,854,904 R121G probably benign Het
Arhgef4 A T 1: 34,723,810 T716S unknown Het
Atg2a T C 19: 6,250,269 probably null Het
Ccdc27 T C 4: 154,033,313 I480V probably null Het
Cdipt T C 7: 126,976,933 V20A possibly damaging Het
Cgrrf1 C T 14: 46,830,445 probably benign Het
Chd7 G A 4: 8,855,226 V2152I probably benign Het
Chd8 T A 14: 52,215,241 S1274C probably damaging Het
Chuk A T 19: 44,107,343 M17K possibly damaging Het
Col14a1 C T 15: 55,446,181 probably benign Het
Col20a1 G A 2: 181,013,163 probably null Het
Cped1 A G 6: 22,143,964 I570V probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Ddx27 A C 2: 167,033,771 Q674P probably damaging Het
Dennd6a T A 14: 26,612,003 F131L probably damaging Het
Dhx38 G A 8: 109,556,869 probably benign Het
Dido1 G T 2: 180,659,585 N2175K unknown Het
Dmxl1 T A 18: 49,889,558 Y1654* probably null Het
Dock7 T A 4: 98,959,101 H1658L probably damaging Het
Dync2h1 T C 9: 7,162,925 I555V probably benign Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Eif2ak2 T C 17: 78,863,963 E337G possibly damaging Het
Fabp12 T A 3: 10,250,149 D46V probably benign Het
Fech C T 18: 64,478,727 E79K probably damaging Het
Flnc A T 6: 29,444,363 I693F probably damaging Het
Foxp2 G A 6: 15,324,644 C97Y possibly damaging Het
Grin2b A G 6: 135,733,896 M884T probably benign Het
Gtf2ird1 T C 5: 134,417,093 D28G probably damaging Het
Gtf3c4 C A 2: 28,833,894 G468W possibly damaging Het
Ift172 A T 5: 31,267,241 L201* probably null Het
Il1rl2 C A 1: 40,365,214 S498R probably damaging Het
Ildr1 C T 16: 36,725,541 R489W probably damaging Het
Itga10 G A 3: 96,652,490 G487D probably damaging Het
Klk8 A G 7: 43,799,216 N128D probably benign Het
Lgr6 G A 1: 135,075,275 T79M probably damaging Het
Med6 T C 12: 81,573,877 T232A probably benign Het
Mgat4e A G 1: 134,541,322 L328P probably damaging Het
Mttp A G 3: 138,118,402 Y138H probably damaging Het
Ngef T C 1: 87,545,968 R31G probably benign Het
Nipsnap2 C A 5: 129,753,223 probably null Het
Nlgn2 G T 11: 69,828,441 N194K probably damaging Het
Olfr1026 A G 2: 85,923,743 I158M probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr1450 G A 19: 12,954,332 V248I possibly damaging Het
Olfr357 G A 2: 36,997,652 V281M possibly damaging Het
Olfr894 A G 9: 38,219,432 Y203C possibly damaging Het
Pcca T A 14: 122,813,222 M101K possibly damaging Het
Plekha6 A G 1: 133,284,970 T671A possibly damaging Het
Prex2 G A 1: 11,162,312 V868M probably damaging Het
Prkcq G A 2: 11,279,521 V501I probably benign Het
Prom1 T A 5: 44,011,253 probably benign Het
Ptprd A G 4: 76,133,161 V41A probably damaging Het
Rab39 C T 9: 53,686,398 G189E possibly damaging Het
Rfx6 G A 10: 51,720,057 probably null Het
Rnf213 A G 11: 119,461,918 T3916A probably damaging Het
Rpn1 A G 6: 88,095,683 N336S probably damaging Het
Sag G A 1: 87,805,315 A2T probably damaging Het
Sco2 T C 15: 89,371,860 Y197C probably damaging Het
Sec23b T C 2: 144,566,944 I183T possibly damaging Het
Sec24b C T 3: 129,987,728 V1166M probably damaging Het
Slc27a5 A T 7: 12,993,412 F361Y probably damaging Het
Spaca9 A G 2: 28,696,001 L17P probably damaging Het
Sqor T C 2: 122,804,107 probably null Het
Stx18 A G 5: 38,135,244 H230R probably damaging Het
Tas2r130 A T 6: 131,630,769 I21N probably damaging Het
Tcaf3 A G 6: 42,593,724 S365P possibly damaging Het
Tinagl1 G A 4: 130,166,972 H351Y probably damaging Het
Tmc2 T C 2: 130,232,385 Y333H probably damaging Het
Trp53bp2 A T 1: 182,442,819 T395S probably damaging Het
Tsc22d1 T C 14: 76,418,333 S751P probably damaging Het
Ttc30a1 A G 2: 75,980,935 V268A probably benign Het
Ttn A G 2: 76,827,024 probably benign Het
Ugdh T C 5: 65,416,925 Y425C probably damaging Het
Vmn1r115 G A 7: 20,844,169 L273F probably null Het
Vmn2r109 A T 17: 20,541,186 C636* probably null Het
Vmn2r59 A C 7: 42,043,779 Y466D probably damaging Het
Zic5 C T 14: 122,464,830 G163D unknown Het
Other mutations in Ret
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Ret APN 6 118175120 splice site probably null
IGL02445:Ret APN 6 118181899 missense probably damaging 0.98
IGL02754:Ret APN 6 118176252 missense probably benign 0.03
IGL02828:Ret APN 6 118176207 missense probably benign 0.00
IGL03058:Ret APN 6 118175067 missense probably damaging 1.00
PIT4151001:Ret UTSW 6 118164741 missense probably benign 0.04
R0126:Ret UTSW 6 118165995 splice site probably benign
R0555:Ret UTSW 6 118178610 missense probably damaging 0.96
R1168:Ret UTSW 6 118173558 missense possibly damaging 0.94
R1829:Ret UTSW 6 118153951 missense probably damaging 0.99
R4082:Ret UTSW 6 118153966 missense possibly damaging 0.81
R4732:Ret UTSW 6 118163193 missense possibly damaging 0.77
R4733:Ret UTSW 6 118163193 missense possibly damaging 0.77
R5356:Ret UTSW 6 118197118 missense possibly damaging 0.73
R5401:Ret UTSW 6 118181975 missense probably benign 0.05
R5572:Ret UTSW 6 118155431 missense probably damaging 1.00
R5669:Ret UTSW 6 118184243 missense probably benign
R6058:Ret UTSW 6 118179319 missense probably benign
R6087:Ret UTSW 6 118176291 missense possibly damaging 0.53
R6412:Ret UTSW 6 118184284 missense probably benign 0.00
R6457:Ret UTSW 6 118173621 missense probably benign 0.01
R6884:Ret UTSW 6 118155401 missense probably damaging 1.00
R7035:Ret UTSW 6 118163286 missense probably damaging 1.00
R7112:Ret UTSW 6 118197102 missense possibly damaging 0.96
R7841:Ret UTSW 6 118155360 missense probably damaging 1.00
R7947:Ret UTSW 6 118174344 missense probably benign 0.32
R8539:Ret UTSW 6 118175809 missense possibly damaging 0.60
R8556:Ret UTSW 6 118169188 missense probably damaging 1.00
R8742:Ret UTSW 6 118178523 missense probably damaging 0.99
R8904:Ret UTSW 6 118180213 splice site probably benign
R9051:Ret UTSW 6 118165927 nonsense probably null
R9323:Ret UTSW 6 118182014 missense probably benign 0.00
R9661:Ret UTSW 6 118173476 missense probably benign
R9674:Ret UTSW 6 118153869 missense probably damaging 1.00
Z1176:Ret UTSW 6 118163207 missense probably damaging 1.00
Z1177:Ret UTSW 6 118153890 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCAAATGCCACTGTGGGACC -3'
(R):5'- CCTCACACAGCCTATATTTGGAG -3'

Sequencing Primer
(F):5'- ACTGTGGGACCAACCTCC -3'
(R):5'- CACACAGCCTATATTTGGAGTACTG -3'
Posted On 2014-08-25