Mutagenetix > Incidental Mutation

Incidental Mutation 'R2020:Ret'

223826

Institutional Source

Beutler Lab

Gene Symbol

Ret

Ensembl Gene

ENSMUSG00000030110

Gene Name

ret proto-oncogene

Synonyms

c-Ret, RET9, RET51

MMRRC Submission

040029-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.765) question?

Stock #

R2020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118151745-118197718 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118180382 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 236 (K236E)

Ref Sequence

ENSEMBL: ENSMUSP00000086169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]

AlphaFold

P35546

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032201
AA Change: K236E

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: K236E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	191	271	1.11e-1	SMART
low complexity region	638	656	N/A	INTRINSIC
TyrKc	725	1006	3.58e-148	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088790
AA Change: K236E

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110
AA Change: K236E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	191	271	1.11e-1	SMART
low complexity region	638	656	N/A	INTRINSIC
TyrKc	725	1006	3.58e-148	SMART

Meta Mutation Damage Score

0.0983

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332		probably null	Het
Akap9	T	C	5: 3,961,967	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269		probably null	Het
Ccdc27	T	C	4: 154,033,313	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445		probably benign	Het
Chd7	G	A	4: 8,855,226	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181		probably benign	Het
Col20a1	G	A	2: 181,013,163		probably null	Het
Cped1	A	G	6: 22,143,964	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003	F131L	probably damaging	Het
Dhx38	G	A	8: 109,556,869		probably benign	Het
Dido1	G	T	2: 180,659,585	N2175K	unknown	Het
Dmxl1	T	A	18: 49,889,558	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101	H1658L	probably damaging	Het
Dync2h1	T	C	9: 7,162,925	I555V	probably benign	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Eif2ak2	T	C	17: 78,863,963	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149	D46V	probably benign	Het
Fech	C	T	18: 64,478,727	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896	M884T	probably benign	Het
Gtf2ird1	T	C	5: 134,417,093	D28G	probably damaging	Het
Gtf3c4	C	A	2: 28,833,894	G468W	possibly damaging	Het
Ift172	A	T	5: 31,267,241	L201*	probably null	Het
Il1rl2	C	A	1: 40,365,214	S498R	probably damaging	Het
Ildr1	C	T	16: 36,725,541	R489W	probably damaging	Het
Itga10	G	A	3: 96,652,490	G487D	probably damaging	Het
Klk8	A	G	7: 43,799,216	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223		probably null	Het
Nlgn2	G	T	11: 69,828,441	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312	V868M	probably damaging	Het
Prkcq	G	A	2: 11,279,521	V501I	probably benign	Het
Prom1	T	A	5: 44,011,253		probably benign	Het
Ptprd	A	G	4: 76,133,161	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398	G189E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057		probably null	Het
Rnf213	A	G	11: 119,461,918	T3916A	probably damaging	Het
Rpn1	A	G	6: 88,095,683	N336S	probably damaging	Het
Sag	G	A	1: 87,805,315	A2T	probably damaging	Het
Sco2	T	C	15: 89,371,860	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944	I183T	possibly damaging	Het
Sec24b	C	T	3: 129,987,728	V1166M	probably damaging	Het
Slc27a5	A	T	7: 12,993,412	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107		probably null	Het
Stx18	A	G	5: 38,135,244	H230R	probably damaging	Het
Tas2r130	A	T	6: 131,630,769	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819	T395S	probably damaging	Het
Tsc22d1	T	C	14: 76,418,333	S751P	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024		probably benign	Het
Ugdh	T	C	5: 65,416,925	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830	G163D	unknown	Het

Other mutations in Ret

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02255:Ret	APN	6	118175120	splice site	probably null
IGL02445:Ret	APN	6	118181899	missense	probably damaging	0.98
IGL02754:Ret	APN	6	118176252	missense	probably benign	0.03
IGL02828:Ret	APN	6	118176207	missense	probably benign	0.00
IGL03058:Ret	APN	6	118175067	missense	probably damaging	1.00
PIT4151001:Ret	UTSW	6	118164741	missense	probably benign	0.04
R0126:Ret	UTSW	6	118165995	splice site	probably benign
R0555:Ret	UTSW	6	118178610	missense	probably damaging	0.96
R1168:Ret	UTSW	6	118173558	missense	possibly damaging	0.94
R1829:Ret	UTSW	6	118153951	missense	probably damaging	0.99
R4082:Ret	UTSW	6	118153966	missense	possibly damaging	0.81
R4732:Ret	UTSW	6	118163193	missense	possibly damaging	0.77
R4733:Ret	UTSW	6	118163193	missense	possibly damaging	0.77
R5356:Ret	UTSW	6	118197118	missense	possibly damaging	0.73
R5401:Ret	UTSW	6	118181975	missense	probably benign	0.05
R5572:Ret	UTSW	6	118155431	missense	probably damaging	1.00
R5669:Ret	UTSW	6	118184243	missense	probably benign
R6058:Ret	UTSW	6	118179319	missense	probably benign
R6087:Ret	UTSW	6	118176291	missense	possibly damaging	0.53
R6412:Ret	UTSW	6	118184284	missense	probably benign	0.00
R6457:Ret	UTSW	6	118173621	missense	probably benign	0.01
R6884:Ret	UTSW	6	118155401	missense	probably damaging	1.00
R7035:Ret	UTSW	6	118163286	missense	probably damaging	1.00
R7112:Ret	UTSW	6	118197102	missense	possibly damaging	0.96
R7841:Ret	UTSW	6	118155360	missense	probably damaging	1.00
R7947:Ret	UTSW	6	118174344	missense	probably benign	0.32
R8539:Ret	UTSW	6	118175809	missense	possibly damaging	0.60
R8556:Ret	UTSW	6	118169188	missense	probably damaging	1.00
R8742:Ret	UTSW	6	118178523	missense	probably damaging	0.99
R8904:Ret	UTSW	6	118180213	splice site	probably benign
R9051:Ret	UTSW	6	118165927	nonsense	probably null
R9323:Ret	UTSW	6	118182014	missense	probably benign	0.00
R9661:Ret	UTSW	6	118173476	missense	probably benign
R9674:Ret	UTSW	6	118153869	missense	probably damaging	1.00
Z1176:Ret	UTSW	6	118163207	missense	probably damaging	1.00
Z1177:Ret	UTSW	6	118153890	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- TCAAATGCCACTGTGGGACC -3'
(R):5'- CCTCACACAGCCTATATTTGGAG -3'

Sequencing Primer
(F):5'- ACTGTGGGACCAACCTCC -3'
(R):5'- CACACAGCCTATATTTGGAGTACTG -3'

Posted On

2014-08-25