Mutagenetix > Incidental Mutations

Incidental Mutation 'R2233:Tbx18'

240187

Institutional Source

Beutler Lab

Gene Symbol

Tbx18

Ensembl Gene

ENSMUSG00000032419

Gene Name

T-box18

Synonyms

2810404D13Rik, 2810012F10Rik

MMRRC Submission

040234-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2233 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87702800-87731260 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 87724350 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 247 (S247R)

Ref Sequence

ENSEMBL: ENSMUSP00000034991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034991]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034991
AA Change: S247R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034991
Gene: ENSMUSG00000032419
AA Change: S247R

Domain	Start	End	E-Value	Type
low complexity region	30	41	N/A	INTRINSIC
low complexity region	67	87	N/A	INTRINSIC
low complexity region	113	132	N/A	INTRINSIC
TBOX	144	341	8.7e-127	SMART
low complexity region	461	476	N/A	INTRINSIC
low complexity region	555	567	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186698

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192660

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice fail to maintain anterior-posterior polarity of the lateral sclerotome and display neonatal lethality and abnormal vertebral, rib and spinal nerve morphology. Mice homozygous for another targeted allele exhibit neonatal lethality, abnormal skeleton and abnormal coronary vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	A	G	1: 63,545,512	I360V	probably benign	Het
Adarb1	A	G	10: 77,317,349	V322A	probably damaging	Het
Atad2b	T	G	12: 5,006,745	F867C	probably damaging	Het
Ccdc24	T	C	4: 117,869,916	K79R	possibly damaging	Het
Cfap44	A	G	16: 44,451,525	I1214V	probably benign	Het
Chrm4	A	G	2: 91,928,530	S428G	probably benign	Het
Chrnb1	A	T	11: 69,795,602	I64N	probably damaging	Het
Crh	A	T	3: 19,693,932	M182K	probably damaging	Het
Dazap1	A	G	10: 80,277,599	K110E	possibly damaging	Het
Dhx16	T	C	17: 35,887,886	C737R	probably damaging	Het
Dst	A	G	1: 34,274,262	E6384G	probably damaging	Het
Dync1i2	C	T	2: 71,249,420	Q419*	probably null	Het
E2f4	T	A	8: 105,298,651	V121E	probably damaging	Het
Enah	G	A	1: 181,921,972	P415L	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	C	6: 23,246,003	T388A	probably damaging	Het
Gimap6	T	A	6: 48,704,484	H72L	possibly damaging	Het
Gm11149	A	G	9: 49,562,146		probably benign	Het
Gm12695	C	T	4: 96,724,029	R499Q	probably damaging	Het
Grhl1	A	G	12: 24,608,511	D385G	probably damaging	Het
Hyou1	C	T	9: 44,389,091	T855M	probably benign	Het
Igf1r	T	A	7: 68,212,080	N1129K	probably damaging	Het
Iglon5	T	C	7: 43,480,638	E34G	probably damaging	Het
Kcnab1	T	A	3: 65,319,467	V189D	probably damaging	Het
Kifap3	T	A	1: 163,856,065	D438E	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrrc41	G	A	4: 116,096,385	R756Q	possibly damaging	Het
Lrrc49	A	T	9: 60,598,157	F538L	possibly damaging	Het
Nphp3	G	A	9: 104,037,376	R1052H	probably benign	Het
Nynrin	G	A	14: 55,872,067	V1544I	possibly damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr1154	G	A	2: 87,903,475	S67F	probably damaging	Het
Olfr1346	T	C	7: 6,474,442	S111P	possibly damaging	Het
Osbpl6	T	C	2: 76,586,769	F577L	probably damaging	Het
Otc	A	G	X: 10,303,367	Q216R	probably benign	Het
Ppp1r12a	A	G	10: 108,198,919	I108M	possibly damaging	Het
Prl7a1	C	A	13: 27,642,419		probably null	Het
Prss16	T	C	13: 22,009,409	D72G	possibly damaging	Het
Qrsl1	T	C	10: 43,896,096	K33E	probably benign	Het
Rabepk	A	T	2: 34,795,234	I58N	possibly damaging	Het
Ralgapa1	A	T	12: 55,717,071	H1403Q	probably benign	Het
Rhobtb3	C	A	13: 75,872,365	C606F	possibly damaging	Het
Rnf216	G	A	5: 143,090,926	H68Y	probably benign	Het
Scap	T	C	9: 110,381,593	C998R	probably damaging	Het
Scgb1b27	T	C	7: 34,021,824	Y46H	probably damaging	Het
Sel1l2	T	C	2: 140,244,165	Y502C	probably damaging	Het
Sf3a2	G	T	10: 80,802,829	A95S	probably benign	Het
Sis	A	T	3: 72,913,194	F1412L	probably benign	Het
Slc25a29	A	T	12: 108,835,661	C9S	possibly damaging	Het
Snap91	T	C	9: 86,798,571	T427A	probably benign	Het
St3gal6	A	G	16: 58,473,534	F211L	probably damaging	Het
Stab1	G	A	14: 31,161,880	S240F	probably benign	Het
Sun3	T	A	11: 9,023,371	K109*	probably null	Het
Syne1	T	C	10: 5,041,484	N8410S	probably benign	Het
Tenm3	T	C	8: 48,276,169	I1601V	probably benign	Het
Tmem135	T	C	7: 89,154,074	N297S	probably damaging	Het
Tnk1	C	T	11: 69,855,191		probably null	Het
Txnl4b	A	G	8: 109,568,919		probably benign	Het
Uck1	T	C	2: 32,258,303	D167G	probably damaging	Het
Vmn2r124	A	T	17: 18,049,665	H61L	possibly damaging	Het
Xylt2	C	T	11: 94,669,996	V239M	possibly damaging	Het
Zmpste24	T	C	4: 121,097,965	D12G	probably benign	Het
Zscan25	A	G	5: 145,283,692	Y99C	probably damaging	Het

Other mutations in Tbx18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Tbx18	APN	9	87705623	missense	possibly damaging	0.90
IGL00832:Tbx18	APN	9	87705661	missense	probably damaging	1.00
IGL01287:Tbx18	APN	9	87724331	missense	probably damaging	0.98
IGL01406:Tbx18	APN	9	87713543	missense	probably damaging	0.99
IGL01587:Tbx18	APN	9	87724408	missense	probably damaging	0.99
IGL01898:Tbx18	APN	9	87707859	missense	possibly damaging	0.92
IGL02624:Tbx18	APN	9	87727406	missense	probably damaging	1.00
IGL03057:Tbx18	APN	9	87730829	missense	probably damaging	0.99
IGL03252:Tbx18	APN	9	87705580	missense	probably damaging	1.00
R0126:Tbx18	UTSW	9	87729653	missense	possibly damaging	0.50
R0243:Tbx18	UTSW	9	87715516	splice site	probably benign
R0374:Tbx18	UTSW	9	87724355	missense	probably damaging	0.97
R0666:Tbx18	UTSW	9	87724409	missense	probably benign	0.13
R2141:Tbx18	UTSW	9	87715653	missense	probably damaging	0.99
R2183:Tbx18	UTSW	9	87705736	missense	probably damaging	0.98
R2234:Tbx18	UTSW	9	87724350	missense	probably damaging	1.00
R2235:Tbx18	UTSW	9	87724350	missense	probably damaging	1.00
R3835:Tbx18	UTSW	9	87729636	missense	probably benign
R4214:Tbx18	UTSW	9	87724465	missense	probably damaging	1.00
R4606:Tbx18	UTSW	9	87730769	missense	possibly damaging	0.84
R4834:Tbx18	UTSW	9	87727449	missense	possibly damaging	0.48
R5112:Tbx18	UTSW	9	87715687	missense	probably damaging	1.00
R5887:Tbx18	UTSW	9	87713513	missense	possibly damaging	0.58
R6628:Tbx18	UTSW	9	87715535	nonsense	probably null
R6659:Tbx18	UTSW	9	87707811	missense	probably damaging	1.00
R7001:Tbx18	UTSW	9	87727404	missense	probably damaging	1.00
R7057:Tbx18	UTSW	9	87705264	missense	possibly damaging	0.94
R7167:Tbx18	UTSW	9	87707830	missense	probably damaging	1.00
R7368:Tbx18	UTSW	9	87730697	missense	probably benign
R8147:Tbx18	UTSW	9	87724358	missense	probably damaging	0.97
R8993:Tbx18	UTSW	9	87730717	missense	probably benign	0.00
R9263:Tbx18	UTSW	9	87729468	missense	probably damaging	0.97
R9291:Tbx18	UTSW	9	87729482	missense	probably damaging	1.00
R9396:Tbx18	UTSW	9	87727379	missense	probably damaging	1.00
R9420:Tbx18	UTSW	9	87730622	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTCTCTGATACAAATACAACCTTG -3'
(R):5'- TATTGGAAAAGGGTGCACACTTG -3'

Sequencing Primer
(F):5'- GATACAAATACAACCTTGATTTGGC -3'
(R):5'- GTTGTTAATTCCAAGGAATGCACAG -3'

Posted On

2014-10-15