Mutagenetix > Incidental Mutation

Incidental Mutation 'R2233:Tbx18'

240187

Institutional Source

Beutler Lab

Gene Symbol

Tbx18

Ensembl Gene

ENSMUSG00000032419

Gene Name

T-box18

Synonyms

2810012F10Rik, 2810404D13Rik

MMRRC Submission

040234-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2233 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87584853-87613313 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 87606403 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 247 (S247R)

Ref Sequence

ENSEMBL: ENSMUSP00000034991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034991]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034991
AA Change: S247R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034991
Gene: ENSMUSG00000032419
AA Change: S247R

Domain	Start	End	E-Value	Type
low complexity region	30	41	N/A	INTRINSIC
low complexity region	67	87	N/A	INTRINSIC
low complexity region	113	132	N/A	INTRINSIC
TBOX	144	341	8.7e-127	SMART
low complexity region	461	476	N/A	INTRINSIC
low complexity region	555	567	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186698

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192660

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice fail to maintain anterior-posterior polarity of the lateral sclerotome and display neonatal lethality and abnormal vertebral, rib and spinal nerve morphology. Mice homozygous for another targeted allele exhibit neonatal lethality, abnormal skeleton and abnormal coronary vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	A	G	1: 63,584,671 (GRCm39)	I360V	probably benign	Het
Adarb1	A	G	10: 77,153,183 (GRCm39)	V322A	probably damaging	Het
Atad2b	T	G	12: 5,056,745 (GRCm39)	F867C	probably damaging	Het
Ccdc24	T	C	4: 117,727,113 (GRCm39)	K79R	possibly damaging	Het
Cfap44	A	G	16: 44,271,888 (GRCm39)	I1214V	probably benign	Het
Chrm4	A	G	2: 91,758,875 (GRCm39)	S428G	probably benign	Het
Chrnb1	A	T	11: 69,686,428 (GRCm39)	I64N	probably damaging	Het
Crh	A	T	3: 19,748,096 (GRCm39)	M182K	probably damaging	Het
Dazap1	A	G	10: 80,113,433 (GRCm39)	K110E	possibly damaging	Het
Dhx16	T	C	17: 36,198,778 (GRCm39)	C737R	probably damaging	Het
Dst	A	G	1: 34,313,343 (GRCm39)	E6384G	probably damaging	Het
Dync1i2	C	T	2: 71,079,764 (GRCm39)	Q419*	probably null	Het
E2f4	T	A	8: 106,025,283 (GRCm39)	V121E	probably damaging	Het
Enah	G	A	1: 181,749,537 (GRCm39)	P415L	probably damaging	Het
Fat3	G	A	9: 15,909,567 (GRCm39)	S2145F	probably damaging	Het
Fezf1	T	C	6: 23,246,002 (GRCm39)	T388A	probably damaging	Het
Gimap6	T	A	6: 48,681,418 (GRCm39)	H72L	possibly damaging	Het
Gm11149	A	G	9: 49,473,446 (GRCm39)		probably benign	Het
Gm12695	C	T	4: 96,612,266 (GRCm39)	R499Q	probably damaging	Het
Grhl1	A	G	12: 24,658,510 (GRCm39)	D385G	probably damaging	Het
Hyou1	C	T	9: 44,300,388 (GRCm39)	T855M	probably benign	Het
Igf1r	T	A	7: 67,861,828 (GRCm39)	N1129K	probably damaging	Het
Iglon5	T	C	7: 43,130,062 (GRCm39)	E34G	probably damaging	Het
Kcnab1	T	A	3: 65,226,888 (GRCm39)	V189D	probably damaging	Het
Kifap3	T	A	1: 163,683,634 (GRCm39)	D438E	probably benign	Het
Lmo2	T	C	2: 103,811,407 (GRCm39)	Y147H	probably damaging	Het
Lrrc41	G	A	4: 115,953,582 (GRCm39)	R756Q	possibly damaging	Het
Lrrc49	A	T	9: 60,505,440 (GRCm39)	F538L	possibly damaging	Het
Nphp3	G	A	9: 103,914,575 (GRCm39)	R1052H	probably benign	Het
Nynrin	G	A	14: 56,109,524 (GRCm39)	V1544I	possibly damaging	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Or6z5	T	C	7: 6,477,441 (GRCm39)	S111P	possibly damaging	Het
Or9m1	G	A	2: 87,733,819 (GRCm39)	S67F	probably damaging	Het
Osbpl6	T	C	2: 76,417,113 (GRCm39)	F577L	probably damaging	Het
Otc	A	G	X: 10,169,606 (GRCm39)	Q216R	probably benign	Het
Ppp1r12a	A	G	10: 108,034,780 (GRCm39)	I108M	possibly damaging	Het
Prl7a1	C	A	13: 27,826,402 (GRCm39)		probably null	Het
Prss16	T	C	13: 22,193,579 (GRCm39)	D72G	possibly damaging	Het
Qrsl1	T	C	10: 43,772,092 (GRCm39)	K33E	probably benign	Het
Rabepk	A	T	2: 34,685,246 (GRCm39)	I58N	possibly damaging	Het
Ralgapa1	A	T	12: 55,763,856 (GRCm39)	H1403Q	probably benign	Het
Rhobtb3	C	A	13: 76,020,484 (GRCm39)	C606F	possibly damaging	Het
Rnf216	G	A	5: 143,076,681 (GRCm39)	H68Y	probably benign	Het
Scap	T	C	9: 110,210,661 (GRCm39)	C998R	probably damaging	Het
Scgb1b27	T	C	7: 33,721,249 (GRCm39)	Y46H	probably damaging	Het
Sel1l2	T	C	2: 140,086,085 (GRCm39)	Y502C	probably damaging	Het
Sf3a2	G	T	10: 80,638,663 (GRCm39)	A95S	probably benign	Het
Sis	A	T	3: 72,820,527 (GRCm39)	F1412L	probably benign	Het
Slc25a29	A	T	12: 108,801,587 (GRCm39)	C9S	possibly damaging	Het
Snap91	T	C	9: 86,680,624 (GRCm39)	T427A	probably benign	Het
St3gal6	A	G	16: 58,293,897 (GRCm39)	F211L	probably damaging	Het
Stab1	G	A	14: 30,883,837 (GRCm39)	S240F	probably benign	Het
Sun3	T	A	11: 8,973,371 (GRCm39)	K109*	probably null	Het
Syne1	T	C	10: 4,991,484 (GRCm39)	N8410S	probably benign	Het
Tenm3	T	C	8: 48,729,204 (GRCm39)	I1601V	probably benign	Het
Tmem135	T	C	7: 88,803,282 (GRCm39)	N297S	probably damaging	Het
Tnk1	C	T	11: 69,746,017 (GRCm39)		probably null	Het
Txnl4b	A	G	8: 110,295,551 (GRCm39)		probably benign	Het
Uck1	T	C	2: 32,148,315 (GRCm39)	D167G	probably damaging	Het
Vmn2r124	A	T	17: 18,269,927 (GRCm39)	H61L	possibly damaging	Het
Xylt2	C	T	11: 94,560,822 (GRCm39)	V239M	possibly damaging	Het
Zmpste24	T	C	4: 120,955,162 (GRCm39)	D12G	probably benign	Het
Zscan25	A	G	5: 145,220,502 (GRCm39)	Y99C	probably damaging	Het

Other mutations in Tbx18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Tbx18	APN	9	87,587,676 (GRCm39)	missense	possibly damaging	0.90
IGL00832:Tbx18	APN	9	87,587,714 (GRCm39)	missense	probably damaging	1.00
IGL01287:Tbx18	APN	9	87,606,384 (GRCm39)	missense	probably damaging	0.98
IGL01406:Tbx18	APN	9	87,595,596 (GRCm39)	missense	probably damaging	0.99
IGL01587:Tbx18	APN	9	87,606,461 (GRCm39)	missense	probably damaging	0.99
IGL01898:Tbx18	APN	9	87,589,912 (GRCm39)	missense	possibly damaging	0.92
IGL02624:Tbx18	APN	9	87,609,459 (GRCm39)	missense	probably damaging	1.00
IGL03057:Tbx18	APN	9	87,612,882 (GRCm39)	missense	probably damaging	0.99
IGL03252:Tbx18	APN	9	87,587,633 (GRCm39)	missense	probably damaging	1.00
R0126:Tbx18	UTSW	9	87,611,706 (GRCm39)	missense	possibly damaging	0.50
R0243:Tbx18	UTSW	9	87,597,569 (GRCm39)	splice site	probably benign
R0374:Tbx18	UTSW	9	87,606,408 (GRCm39)	missense	probably damaging	0.97
R0666:Tbx18	UTSW	9	87,606,462 (GRCm39)	missense	probably benign	0.13
R2141:Tbx18	UTSW	9	87,597,706 (GRCm39)	missense	probably damaging	0.99
R2183:Tbx18	UTSW	9	87,587,789 (GRCm39)	missense	probably damaging	0.98
R2234:Tbx18	UTSW	9	87,606,403 (GRCm39)	missense	probably damaging	1.00
R2235:Tbx18	UTSW	9	87,606,403 (GRCm39)	missense	probably damaging	1.00
R3835:Tbx18	UTSW	9	87,611,689 (GRCm39)	missense	probably benign
R4214:Tbx18	UTSW	9	87,606,518 (GRCm39)	missense	probably damaging	1.00
R4606:Tbx18	UTSW	9	87,612,822 (GRCm39)	missense	possibly damaging	0.84
R4834:Tbx18	UTSW	9	87,609,502 (GRCm39)	missense	possibly damaging	0.48
R5112:Tbx18	UTSW	9	87,597,740 (GRCm39)	missense	probably damaging	1.00
R5887:Tbx18	UTSW	9	87,595,566 (GRCm39)	missense	possibly damaging	0.58
R6628:Tbx18	UTSW	9	87,597,588 (GRCm39)	nonsense	probably null
R6659:Tbx18	UTSW	9	87,589,864 (GRCm39)	missense	probably damaging	1.00
R7001:Tbx18	UTSW	9	87,609,457 (GRCm39)	missense	probably damaging	1.00
R7057:Tbx18	UTSW	9	87,587,317 (GRCm39)	missense	possibly damaging	0.94
R7167:Tbx18	UTSW	9	87,589,883 (GRCm39)	missense	probably damaging	1.00
R7368:Tbx18	UTSW	9	87,612,750 (GRCm39)	missense	probably benign
R8147:Tbx18	UTSW	9	87,606,411 (GRCm39)	missense	probably damaging	0.97
R8993:Tbx18	UTSW	9	87,612,770 (GRCm39)	missense	probably benign	0.00
R9263:Tbx18	UTSW	9	87,611,521 (GRCm39)	missense	probably damaging	0.97
R9291:Tbx18	UTSW	9	87,611,535 (GRCm39)	missense	probably damaging	1.00
R9396:Tbx18	UTSW	9	87,609,432 (GRCm39)	missense	probably damaging	1.00
R9420:Tbx18	UTSW	9	87,612,675 (GRCm39)	missense	probably benign
R9508:Tbx18	UTSW	9	87,587,926 (GRCm39)	missense	probably damaging	0.96
R9577:Tbx18	UTSW	9	87,611,512 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGTCTCTGATACAAATACAACCTTG -3'
(R):5'- TATTGGAAAAGGGTGCACACTTG -3'

Sequencing Primer
(F):5'- GATACAAATACAACCTTGATTTGGC -3'
(R):5'- GTTGTTAATTCCAAGGAATGCACAG -3'

Posted On

2014-10-15