Incidental Mutation 'R9389:Mast4'
ID 710505
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Name microtubule associated serine/threonine kinase family member 4
Synonyms 4930420O11Rik
MMRRC Submission
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Essential gene? Possibly non essential (E-score: 0.328) question?
Stock # R9389 (G1)
Quality Score 189.009
Status Not validated
Chromosome 13
Chromosomal Location 102732486-103334497 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 103333930 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 88 (R88L)
Ref Sequence ENSEMBL: ENSMUSP00000128464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164111] [ENSMUST00000166726] [ENSMUST00000167058]
AlphaFold Q811L6
Predicted Effect probably benign
Transcript: ENSMUST00000164111
AA Change: R88L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000126625
Gene: ENSMUSG00000034751
AA Change: R88L

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166726
AA Change: R88L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751
AA Change: R88L

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167058
AA Change: R88L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: R88L

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik C T 6: 41,033,145 G85D probably benign Het
4931440F15Rik A G 11: 29,825,107 S117P probably damaging Het
Abcb1b G A 5: 8,825,614 V596I probably benign Het
Agtpbp1 A T 13: 59,466,070 M1019K probably damaging Het
Arfgef3 A G 10: 18,603,523 V1448A probably damaging Het
Baz1a T A 12: 54,916,823 E828D probably damaging Het
Ces1f A T 8: 93,269,972 probably null Het
Cfap53 T A 18: 74,299,343 probably null Het
Col6a4 T C 9: 106,000,784 Y1998C probably damaging Het
Col9a2 A G 4: 121,054,751 T675A probably benign Het
Dusp6 G A 10: 99,263,977 V96M possibly damaging Het
Elmo1 T G 13: 20,185,491 M22R probably benign Het
Gm19965 A G 1: 116,821,836 N416D Het
Gpr162 A G 6: 124,861,394 Y98H probably damaging Het
Igfals G A 17: 24,881,626 V564I probably benign Het
Il4 C T 11: 53,614,010 R76H probably damaging Het
Itgb1 T A 8: 128,707,156 N50K probably benign Het
Itpr3 A T 17: 27,095,925 Y682F possibly damaging Het
Jak3 C T 8: 71,684,052 P668S probably damaging Het
Malrd1 A T 2: 15,703,156 N932I unknown Het
Mfsd11 T G 11: 116,873,335 S381A probably benign Het
Mrm3 A G 11: 76,250,030 D288G probably damaging Het
Myg1 G T 15: 102,336,937 V198F probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Npy6r T C 18: 44,275,692 I60T probably damaging Het
Olfr1109 A T 2: 87,093,046 M117K possibly damaging Het
Olfr1308 G T 2: 111,960,527 P182H probably damaging Het
Olfr1341 A T 4: 118,710,156 M250L probably benign Het
Olfr177 C T 16: 58,872,613 C179Y probably damaging Het
Olfr530 T C 7: 140,373,017 T198A probably benign Het
Olfr811 G A 10: 129,801,671 P285S probably damaging Het
Ovgp1 CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA 3: 105,986,525 probably benign Het
Oxtr C A 6: 112,489,349 R150L probably damaging Het
Pappa A T 4: 65,180,888 Y548F probably damaging Het
Pip4k2a T C 2: 18,908,079 K73R probably damaging Het
Pla2g4f T A 2: 120,302,300 D685V probably damaging Het
Ppp1r35 T A 5: 137,779,315 L81Q probably damaging Het
Ptprf C A 4: 118,236,039 A469S probably benign Het
Ranbp3l T A 15: 9,057,223 N322K probably damaging Het
Rev3l T A 10: 39,822,971 Y1155N possibly damaging Het
Rfesd T C 13: 76,003,012 Y96C probably damaging Het
Runx1 C T 16: 92,613,680 V283I possibly damaging Het
Sema5b A C 16: 35,645,722 Q125P probably damaging Het
Spef2 A T 15: 9,725,221 M150K probably damaging Het
Srcap T G 7: 127,542,283 L1745W probably damaging Het
Srgap2 A G 1: 131,355,627 Y239H probably damaging Het
Svil T A 18: 5,090,811 H1304Q possibly damaging Het
Syne1 T C 10: 5,229,193 D4427G possibly damaging Het
Tg T A 15: 66,689,324 M1065K probably benign Het
Tgm2 T C 2: 158,117,896 T656A probably benign Het
Ttc37 A G 13: 76,127,039 D403G probably benign Het
Ubr4 A G 4: 139,425,924 K809E Het
Vmn1r88 T C 7: 13,178,619 S301P probably damaging Het
Wdr27 A G 17: 14,891,718 V671A possibly damaging Het
Zbtb17 G A 4: 141,465,820 V550I possibly damaging Het
Zeb2 A T 2: 44,997,908 I379N probably damaging Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
skinnybones UTSW 13 102804641 critical splice donor site probably null
BB010:Mast4 UTSW 13 102772563 missense probably damaging 0.99
BB020:Mast4 UTSW 13 102772563 missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
R7332:Mast4 UTSW 13 102751424 missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102804641 critical splice donor site probably null
R7514:Mast4 UTSW 13 102787426 nonsense probably null
R7697:Mast4 UTSW 13 102739203 missense probably damaging 1.00
R7820:Mast4 UTSW 13 102754088 missense probably damaging 1.00
R7874:Mast4 UTSW 13 102739275 missense probably damaging 1.00
R7933:Mast4 UTSW 13 102772563 missense probably damaging 0.99
R8042:Mast4 UTSW 13 102781245 missense probably damaging 0.96
R8060:Mast4 UTSW 13 102737676 missense possibly damaging 0.89
R8172:Mast4 UTSW 13 102953125 critical splice donor site probably null
R8206:Mast4 UTSW 13 102735739 missense probably damaging 1.00
R8248:Mast4 UTSW 13 102738721 missense probably damaging 1.00
R8283:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R8346:Mast4 UTSW 13 102751478 missense probably damaging 0.99
R8434:Mast4 UTSW 13 102761392 missense probably damaging 1.00
R8796:Mast4 UTSW 13 102783391 missense probably benign 0.07
R8850:Mast4 UTSW 13 102758666 missense probably damaging 1.00
R9012:Mast4 UTSW 13 102798098 missense probably benign 0.05
R9375:Mast4 UTSW 13 102781245 missense probably damaging 0.99
R9404:Mast4 UTSW 13 102751425 missense probably damaging 1.00
R9520:Mast4 UTSW 13 102789024 missense probably damaging 1.00
R9525:Mast4 UTSW 13 102736436 missense probably benign 0.00
R9526:Mast4 UTSW 13 102737085 missense probably benign 0.00
R9709:Mast4 UTSW 13 102774203 missense probably damaging 1.00
R9790:Mast4 UTSW 13 102754197 missense probably benign 0.01
R9791:Mast4 UTSW 13 102754197 missense probably benign 0.01
RF005:Mast4 UTSW 13 102736307 small insertion probably benign
RF015:Mast4 UTSW 13 102739247 frame shift probably null
RF019:Mast4 UTSW 13 102736307 small insertion probably benign
RF037:Mast4 UTSW 13 102739241 small deletion probably benign
RF039:Mast4 UTSW 13 102739241 small deletion probably benign
RF040:Mast4 UTSW 13 102739241 small deletion probably benign
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102738460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGAGCACCTTTAGTTCC -3'
(R):5'- ACTTTGGGCCGAAAAGGGAC -3'

Sequencing Primer
(F):5'- AGAGCACCTTTAGTTCCCTCCC -3'
(R):5'- AGAAAGTTTCCGAGGCGCC -3'
Posted On 2022-04-18