Mutagenetix > Incidental Mutation

Incidental Mutation 'R9389:Mast4'

710505

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R9389 (G1)

Quality Score

189.009

Status

Not validated

Chromosome

Chromosomal Location

102868994-103471005 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 103470438 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 88 (R88L)

Ref Sequence

ENSEMBL: ENSMUSP00000128464 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164111] [ENSMUST00000166726] [ENSMUST00000167058]

AlphaFold

Q811L6

Predicted Effect

probably benign
Transcript: ENSMUST00000164111
AA Change: R88L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000126625
Gene: ENSMUSG00000034751
AA Change: R88L

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166726
AA Change: R88L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751
AA Change: R88L

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167058
AA Change: R88L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: R88L

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	G	A	5: 8,875,614 (GRCm39)	V596I	probably benign	Het
Agtpbp1	A	T	13: 59,613,884 (GRCm39)	M1019K	probably damaging	Het
Arfgef3	A	G	10: 18,479,271 (GRCm39)	V1448A	probably damaging	Het
Baz1a	T	A	12: 54,963,608 (GRCm39)	E828D	probably damaging	Het
Ces1f	A	T	8: 93,996,600 (GRCm39)		probably null	Het
Cfap53	T	A	18: 74,432,414 (GRCm39)		probably null	Het
Col6a4	T	C	9: 105,877,983 (GRCm39)	Y1998C	probably damaging	Het
Col9a2	A	G	4: 120,911,948 (GRCm39)	T675A	probably benign	Het
Dusp6	G	A	10: 99,099,839 (GRCm39)	V96M	possibly damaging	Het
Elmo1	T	G	13: 20,369,661 (GRCm39)	M22R	probably benign	Het
Fem1al	A	G	11: 29,775,107 (GRCm39)	S117P	probably damaging	Het
Gm19965	A	G	1: 116,749,566 (GRCm39)	N416D		Het
Gpr162	A	G	6: 124,838,357 (GRCm39)	Y98H	probably damaging	Het
Igfals	G	A	17: 25,100,600 (GRCm39)	V564I	probably benign	Het
Il4	C	T	11: 53,504,837 (GRCm39)	R76H	probably damaging	Het
Itgb1	T	A	8: 129,433,637 (GRCm39)	N50K	probably benign	Het
Itpr3	A	T	17: 27,314,899 (GRCm39)	Y682F	possibly damaging	Het
Jak3	C	T	8: 72,136,696 (GRCm39)	P668S	probably damaging	Het
Malrd1	A	T	2: 15,707,967 (GRCm39)	N932I	unknown	Het
Mfsd11	T	G	11: 116,764,161 (GRCm39)	S381A	probably benign	Het
Mrm3	A	G	11: 76,140,856 (GRCm39)	D288G	probably damaging	Het
Myg1	G	T	15: 102,245,372 (GRCm39)	V198F	probably damaging	Het
Naip5	T	A	13: 100,356,338 (GRCm39)	E1092D	probably benign	Het
Npy6r	T	C	18: 44,408,759 (GRCm39)	I60T	probably damaging	Het
Or12j3	T	C	7: 139,952,930 (GRCm39)	T198A	probably benign	Het
Or13p3	A	T	4: 118,567,353 (GRCm39)	M250L	probably benign	Het
Or4f57	G	T	2: 111,790,872 (GRCm39)	P182H	probably damaging	Het
Or5aq6	A	T	2: 86,923,390 (GRCm39)	M117K	possibly damaging	Het
Or5k14	C	T	16: 58,692,976 (GRCm39)	C179Y	probably damaging	Het
Or6c215	G	A	10: 129,637,540 (GRCm39)	P285S	probably damaging	Het
Ovgp1	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA	3: 105,893,841 (GRCm39)		probably benign	Het
Oxtr	C	A	6: 112,466,310 (GRCm39)	R150L	probably damaging	Het
Pappa	A	T	4: 65,099,125 (GRCm39)	Y548F	probably damaging	Het
Pip4k2a	T	C	2: 18,912,890 (GRCm39)	K73R	probably damaging	Het
Pla2g4f	T	A	2: 120,132,781 (GRCm39)	D685V	probably damaging	Het
Ppp1r35	T	A	5: 137,777,577 (GRCm39)	L81Q	probably damaging	Het
Prss3b	C	T	6: 41,010,079 (GRCm39)	G85D	probably benign	Het
Ptprf	C	A	4: 118,093,236 (GRCm39)	A469S	probably benign	Het
Ranbp3l	T	A	15: 9,057,304 (GRCm39)	N322K	probably damaging	Het
Rev3l	T	A	10: 39,698,967 (GRCm39)	Y1155N	possibly damaging	Het
Rfesd	T	C	13: 76,151,131 (GRCm39)	Y96C	probably damaging	Het
Runx1	C	T	16: 92,410,568 (GRCm39)	V283I	possibly damaging	Het
Sema5b	A	C	16: 35,466,092 (GRCm39)	Q125P	probably damaging	Het
Skic3	A	G	13: 76,275,158 (GRCm39)	D403G	probably benign	Het
Spef2	A	T	15: 9,725,307 (GRCm39)	M150K	probably damaging	Het
Srcap	T	G	7: 127,141,455 (GRCm39)	L1745W	probably damaging	Het
Srgap2	A	G	1: 131,283,365 (GRCm39)	Y239H	probably damaging	Het
Svil	T	A	18: 5,090,811 (GRCm39)	H1304Q	possibly damaging	Het
Syne1	T	C	10: 5,179,193 (GRCm39)	D4427G	possibly damaging	Het
Tg	T	A	15: 66,561,173 (GRCm39)	M1065K	probably benign	Het
Tgm2	T	C	2: 157,959,816 (GRCm39)	T656A	probably benign	Het
Ubr4	A	G	4: 139,153,235 (GRCm39)	K809E		Het
Vmn1r88	T	C	7: 12,912,546 (GRCm39)	S301P	probably damaging	Het
Wdr27	A	G	17: 15,111,980 (GRCm39)	V671A	possibly damaging	Het
Zbtb17	G	A	4: 141,193,131 (GRCm39)	V550I	possibly damaging	Het
Zeb2	A	T	2: 44,887,920 (GRCm39)	I379N	probably damaging	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102,907,275 (GRCm39)	nonsense	probably null
IGL00933:Mast4	APN	13	102,871,874 (GRCm39)	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102,910,744 (GRCm39)	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102,890,576 (GRCm39)	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102,897,523 (GRCm39)	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102,904,401 (GRCm39)	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102,887,020 (GRCm39)	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102,874,123 (GRCm39)	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102,873,749 (GRCm39)	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102,910,781 (GRCm39)	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102,874,482 (GRCm39)	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102,878,545 (GRCm39)	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102,872,004 (GRCm39)	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102,990,331 (GRCm39)	makesense	probably null
IGL02850:Mast4	APN	13	102,890,740 (GRCm39)	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102,872,184 (GRCm39)	missense	probably benign
IGL03064:Mast4	APN	13	102,897,472 (GRCm39)	nonsense	probably null
IGL03124:Mast4	APN	13	102,874,753 (GRCm39)	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102,874,163 (GRCm39)	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102,890,764 (GRCm39)	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102,887,905 (GRCm39)	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102,873,615 (GRCm39)	missense	possibly damaging	0.46
buck	UTSW	13	102,897,801 (GRCm39)	critical splice donor site	probably null
doe	UTSW	13	103,042,185 (GRCm39)	missense	possibly damaging	0.85
skinnybones	UTSW	13	102,941,149 (GRCm39)	critical splice donor site	probably null
BB010:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
BB020:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
FR4304:Mast4	UTSW	13	102,871,370 (GRCm39)	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102,872,825 (GRCm39)	small insertion	probably benign
FR4340:Mast4	UTSW	13	102,871,365 (GRCm39)	frame shift	probably null
FR4548:Mast4	UTSW	13	102,872,826 (GRCm39)	small insertion	probably benign
FR4976:Mast4	UTSW	13	102,875,755 (GRCm39)	frame shift	probably null
FR4976:Mast4	UTSW	13	102,872,820 (GRCm39)	small insertion	probably benign
NA:Mast4	UTSW	13	102,878,565 (GRCm39)	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102,941,226 (GRCm39)	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102,878,566 (GRCm39)	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103,470,723 (GRCm39)	start gained	probably benign
R0242:Mast4	UTSW	13	102,990,350 (GRCm39)	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102,890,669 (GRCm39)	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102,871,781 (GRCm39)	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102,888,068 (GRCm39)	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102,895,252 (GRCm39)	splice site	probably benign
R0744:Mast4	UTSW	13	102,873,895 (GRCm39)	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102,990,408 (GRCm39)	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102,907,292 (GRCm39)	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102,872,004 (GRCm39)	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102,887,086 (GRCm39)	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102,872,916 (GRCm39)	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102,872,916 (GRCm39)	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102,909,027 (GRCm39)	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102,873,431 (GRCm39)	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102,875,771 (GRCm39)	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102,930,625 (GRCm39)	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102,887,917 (GRCm39)	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102,875,354 (GRCm39)	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102,895,601 (GRCm39)	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102,887,054 (GRCm39)	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102,890,713 (GRCm39)	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102,871,983 (GRCm39)	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102,872,259 (GRCm39)	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102,934,715 (GRCm39)	splice site	probably benign
R2370:Mast4	UTSW	13	102,910,695 (GRCm39)	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102,875,147 (GRCm39)	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102,990,350 (GRCm39)	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102,872,939 (GRCm39)	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102,990,434 (GRCm39)	splice site	probably benign
R3434:Mast4	UTSW	13	102,923,887 (GRCm39)	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102,923,887 (GRCm39)	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102,923,927 (GRCm39)	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102,875,319 (GRCm39)	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102,895,177 (GRCm39)	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4021:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4022:Mast4	UTSW	13	102,990,377 (GRCm39)	missense	probably damaging	1.00
R4022:Mast4	UTSW	13	102,875,829 (GRCm39)	nonsense	probably null
R4210:Mast4	UTSW	13	102,875,713 (GRCm39)	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102,910,756 (GRCm39)	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102,873,766 (GRCm39)	nonsense	probably null
R4627:Mast4	UTSW	13	103,470,529 (GRCm39)	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103,470,627 (GRCm39)	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102,909,080 (GRCm39)	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102,909,080 (GRCm39)	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102,910,692 (GRCm39)	critical splice donor site	probably null
R4995:Mast4	UTSW	13	103,042,262 (GRCm39)	intron	probably benign
R5059:Mast4	UTSW	13	102,887,071 (GRCm39)	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102,875,391 (GRCm39)	nonsense	probably null
R5101:Mast4	UTSW	13	102,872,864 (GRCm39)	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102,890,723 (GRCm39)	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102,873,987 (GRCm39)	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102,930,580 (GRCm39)	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102,910,701 (GRCm39)	nonsense	probably null
R5906:Mast4	UTSW	13	102,872,252 (GRCm39)	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102,874,764 (GRCm39)	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102,872,148 (GRCm39)	missense	probably benign
R5987:Mast4	UTSW	13	102,895,242 (GRCm39)	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102,990,391 (GRCm39)	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102,923,929 (GRCm39)	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102,923,929 (GRCm39)	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102,872,717 (GRCm39)	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102,897,890 (GRCm39)	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102,872,493 (GRCm39)	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	103,042,185 (GRCm39)	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102,897,801 (GRCm39)	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102,874,004 (GRCm39)	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102,941,222 (GRCm39)	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102,934,586 (GRCm39)	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102,872,482 (GRCm39)	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102,941,155 (GRCm39)	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102,874,223 (GRCm39)	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103,470,508 (GRCm39)	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102,874,986 (GRCm39)	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102,930,511 (GRCm39)	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102,887,932 (GRCm39)	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102,941,149 (GRCm39)	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102,923,934 (GRCm39)	nonsense	probably null
R7697:Mast4	UTSW	13	102,875,711 (GRCm39)	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102,890,596 (GRCm39)	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102,875,783 (GRCm39)	missense	probably damaging	1.00
R7933:Mast4	UTSW	13	102,909,071 (GRCm39)	missense	probably damaging	0.99
R8042:Mast4	UTSW	13	102,917,753 (GRCm39)	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102,874,184 (GRCm39)	missense	possibly damaging	0.89
R8172:Mast4	UTSW	13	103,089,633 (GRCm39)	critical splice donor site	probably null
R8206:Mast4	UTSW	13	102,872,247 (GRCm39)	missense	probably damaging	1.00
R8248:Mast4	UTSW	13	102,875,229 (GRCm39)	missense	probably damaging	1.00
R8283:Mast4	UTSW	13	102,895,177 (GRCm39)	missense	probably damaging	1.00
R8346:Mast4	UTSW	13	102,887,986 (GRCm39)	missense	probably damaging	0.99
R8434:Mast4	UTSW	13	102,897,900 (GRCm39)	missense	probably damaging	1.00
R8796:Mast4	UTSW	13	102,919,899 (GRCm39)	missense	probably benign	0.07
R8850:Mast4	UTSW	13	102,895,174 (GRCm39)	missense	probably damaging	1.00
R9012:Mast4	UTSW	13	102,934,606 (GRCm39)	missense	probably benign	0.05
R9375:Mast4	UTSW	13	102,917,753 (GRCm39)	missense	probably damaging	0.99
R9404:Mast4	UTSW	13	102,887,933 (GRCm39)	missense	probably damaging	1.00
R9520:Mast4	UTSW	13	102,925,532 (GRCm39)	missense	probably damaging	1.00
R9525:Mast4	UTSW	13	102,872,944 (GRCm39)	missense	probably benign	0.00
R9526:Mast4	UTSW	13	102,873,593 (GRCm39)	missense	probably benign	0.00
R9709:Mast4	UTSW	13	102,910,711 (GRCm39)	missense	probably damaging	1.00
R9790:Mast4	UTSW	13	102,890,705 (GRCm39)	missense	probably benign	0.01
R9791:Mast4	UTSW	13	102,890,705 (GRCm39)	missense	probably benign	0.01
RF005:Mast4	UTSW	13	102,872,815 (GRCm39)	small insertion	probably benign
RF015:Mast4	UTSW	13	102,875,755 (GRCm39)	frame shift	probably null
RF019:Mast4	UTSW	13	102,872,815 (GRCm39)	small insertion	probably benign
RF037:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
RF039:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
RF040:Mast4	UTSW	13	102,875,749 (GRCm39)	small deletion	probably benign
Z1088:Mast4	UTSW	13	102,875,027 (GRCm39)	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102,874,968 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAGAGCACCTTTAGTTCC -3'
(R):5'- ACTTTGGGCCGAAAAGGGAC -3'

Sequencing Primer
(F):5'- AGAGCACCTTTAGTTCCCTCCC -3'
(R):5'- AGAAAGTTTCCGAGGCGCC -3'

Posted On

2022-04-18