Incidental Mutation 'R2332:Speer4f1'
ID 246463
Institutional Source Beutler Lab
Gene Symbol Speer4f1
Ensembl Gene ENSMUSG00000058643
Gene Name spermatogenesis associated glutamate (E)-rich protein 4F1
Synonyms 4922502J04Rik, Speer4f, SPEER-4F
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock # R2332 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 17476098-17480936 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 17479524 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 183 (N183K)
Ref Sequence ENSEMBL: ENSMUSP00000075467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076099]
AlphaFold Q9D5Q6
Predicted Effect probably damaging
Transcript: ENSMUST00000076099
AA Change: N183K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075467
Gene: ENSMUSG00000058643
AA Change: N183K

DomainStartEndE-ValueType
Pfam:Takusan 50 128 1.2e-19 PFAM
low complexity region 224 258 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Map3k13 G A 16: 21,898,677 probably null Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Speer4f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03344:Speer4f1 APN 5 17480334 missense possibly damaging 0.88
IGL02837:Speer4f1 UTSW 5 17480383 missense unknown
PIT4508001:Speer4f1 UTSW 5 17480414 missense unknown
PIT4514001:Speer4f1 UTSW 5 17478756 missense possibly damaging 0.94
R0165:Speer4f1 UTSW 5 17479514 nonsense probably null
R1557:Speer4f1 UTSW 5 17479492 missense probably damaging 1.00
R1740:Speer4f1 UTSW 5 17478761 missense probably damaging 1.00
R3890:Speer4f1 UTSW 5 17479502 missense probably damaging 0.98
R4659:Speer4f1 UTSW 5 17476223 missense possibly damaging 0.75
R4718:Speer4f1 UTSW 5 17480424 missense unknown
R5322:Speer4f1 UTSW 5 17477349 missense possibly damaging 0.47
R6075:Speer4f1 UTSW 5 17479484 missense possibly damaging 0.95
R6134:Speer4f1 UTSW 5 17476142 missense probably benign 0.10
R6192:Speer4f1 UTSW 5 17479495 missense probably damaging 1.00
R6277:Speer4f1 UTSW 5 17476243 missense probably damaging 0.99
R6803:Speer4f1 UTSW 5 17479390 splice site probably null
R7820:Speer4f1 UTSW 5 17479530 missense probably damaging 1.00
Z1088:Speer4f1 UTSW 5 17479479 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGGGTACAGGTCAGGTTAATG -3'
(R):5'- CCAGAATGCTTGTGTGAAGACAG -3'

Sequencing Primer
(F):5'- AGGTTAATGGGACCTGTAAGTAG -3'
(R):5'- TGAACAGCTACATTCCATGAGG -3'
Posted On 2014-10-30