Mutagenetix > Incidental Mutations

Incidental Mutation 'R2332:Speer4f1'

246463

Institutional Source

Beutler Lab

Gene Symbol

Speer4f1

Ensembl Gene

ENSMUSG00000058643

Gene Name

spermatogenesis associated glutamate (E)-rich protein 4F1

Synonyms

4922502J04Rik, Speer4f, SPEER-4F

MMRRC Submission

040322-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R2332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

17476098-17480936 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 17479524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 183 (N183K)

Ref Sequence

ENSEMBL: ENSMUSP00000075467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076099]

AlphaFold

Q9D5Q6

Predicted Effect

probably damaging
Transcript: ENSMUST00000076099
AA Change: N183K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000075467
Gene: ENSMUSG00000058643
AA Change: N183K

Domain	Start	End	E-Value	Type
Pfam:Takusan	50	128	1.2e-19	PFAM
low complexity region	224	258	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (47/48)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	T	C	18: 34,317,059	I2302T	possibly damaging	Het
Apoa4	G	A	9: 46,242,355	V85I	probably benign	Het
Banf1	C	T	19: 5,365,030	W84*	probably null	Het
Cdk13	A	G	13: 17,718,695	L627P	probably damaging	Het
Cep250	A	G	2: 155,990,607	E1483G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ddx60	A	G	8: 62,037,091	E1698G	probably benign	Het
Depdc1a	C	A	3: 159,523,866	Q612K	probably damaging	Het
Dnaja2	G	A	8: 85,540,136	R321C	probably damaging	Het
Fam186b	T	A	15: 99,280,428	E339V	probably benign	Het
Fga	T	C	3: 83,031,397	F360L	probably damaging	Het
Fut9	C	T	4: 25,619,823	W330*	probably null	Het
Ghr	T	C	15: 3,320,409	N429S	probably benign	Het
Gm5444	A	T	13: 4,833,625		noncoding transcript	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Hoxa5	T	C	6: 52,202,679	I239V	probably damaging	Het
Hps6	T	C	19: 46,004,491	V289A	possibly damaging	Het
Iqcb1	A	G	16: 36,843,439	N190D	possibly damaging	Het
Map3k13	G	A	16: 21,898,677		probably null	Het
Olfr1115	T	C	2: 87,252,873	V312A	possibly damaging	Het
Olfr607	A	G	7: 103,461,086	Y41H	probably damaging	Het
Pacsin1	A	G	17: 27,704,911	E93G	possibly damaging	Het
Pds5a	A	G	5: 65,627,079		probably null	Het
Ppp1r9b	A	T	11: 94,996,609	E482D	probably damaging	Het
Rhobtb3	A	G	13: 75,910,852	S276P	probably benign	Het
Rimbp2	A	G	5: 128,789,641	V538A	probably benign	Het
Rmdn3	A	T	2: 119,153,527		probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Slc4a11	A	T	2: 130,684,459	V855D	probably benign	Het
Sstr4	A	T	2: 148,396,410	N314Y	probably damaging	Het
Synj2	A	G	17: 6,023,794	K288E	probably damaging	Het
Trhde	T	A	10: 114,592,165	N409Y	probably damaging	Het
Ttn	A	T	2: 76,781,139	W15604R	probably damaging	Het
Ugdh	C	T	5: 65,427,484	V32I	possibly damaging	Het
Uhrf1	C	A	17: 56,310,671		probably null	Het
Vps13d	G	T	4: 145,148,686	D1750E	probably benign	Het
Wdfy3	A	G	5: 101,888,323		probably benign	Het
Wnt4	C	A	4: 137,296,520	T266K	probably benign	Het
Wtap	C	T	17: 12,967,538	R374Q	possibly damaging	Het
Zfp322a	A	T	13: 23,357,324	C83S	probably damaging	Het

Other mutations in Speer4f1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03344:Speer4f1	APN	5	17480334	missense	possibly damaging	0.88
IGL02837:Speer4f1	UTSW	5	17480383	missense	unknown
PIT4508001:Speer4f1	UTSW	5	17480414	missense	unknown
PIT4514001:Speer4f1	UTSW	5	17478756	missense	possibly damaging	0.94
R0165:Speer4f1	UTSW	5	17479514	nonsense	probably null
R1557:Speer4f1	UTSW	5	17479492	missense	probably damaging	1.00
R1740:Speer4f1	UTSW	5	17478761	missense	probably damaging	1.00
R3890:Speer4f1	UTSW	5	17479502	missense	probably damaging	0.98
R4659:Speer4f1	UTSW	5	17476223	missense	possibly damaging	0.75
R4718:Speer4f1	UTSW	5	17480424	missense	unknown
R5322:Speer4f1	UTSW	5	17477349	missense	possibly damaging	0.47
R6075:Speer4f1	UTSW	5	17479484	missense	possibly damaging	0.95
R6134:Speer4f1	UTSW	5	17476142	missense	probably benign	0.10
R6192:Speer4f1	UTSW	5	17479495	missense	probably damaging	1.00
R6277:Speer4f1	UTSW	5	17476243	missense	probably damaging	0.99
R6803:Speer4f1	UTSW	5	17479390	splice site	probably null
R7820:Speer4f1	UTSW	5	17479530	missense	probably damaging	1.00
Z1088:Speer4f1	UTSW	5	17479479	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCAGGGTACAGGTCAGGTTAATG -3'
(R):5'- CCAGAATGCTTGTGTGAAGACAG -3'

Sequencing Primer
(F):5'- AGGTTAATGGGACCTGTAAGTAG -3'
(R):5'- TGAACAGCTACATTCCATGAGG -3'

Posted On

2014-10-30