Incidental Mutation 'R2332:Map3k13'
ID 246484
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Name mitogen-activated protein kinase kinase kinase 13
Synonyms
MMRRC Submission 040322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2332 (G1)
Quality Score 201
Status Validated
Chromosome 16
Chromosomal Location 21794346-21933439 bp(+) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 21898677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000231988] [ENSMUST00000232240] [ENSMUST00000232240]
AlphaFold Q1HKZ5
Predicted Effect probably null
Transcript: ENSMUST00000042065
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042065
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171547
Predicted Effect probably null
Transcript: ENSMUST00000231988
Predicted Effect probably null
Transcript: ENSMUST00000231988
Predicted Effect probably null
Transcript: ENSMUST00000232240
Predicted Effect probably null
Transcript: ENSMUST00000232240
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc T C 18: 34,317,059 I2302T possibly damaging Het
Apoa4 G A 9: 46,242,355 V85I probably benign Het
Banf1 C T 19: 5,365,030 W84* probably null Het
Cdk13 A G 13: 17,718,695 L627P probably damaging Het
Cep250 A G 2: 155,990,607 E1483G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ddx60 A G 8: 62,037,091 E1698G probably benign Het
Depdc1a C A 3: 159,523,866 Q612K probably damaging Het
Dnaja2 G A 8: 85,540,136 R321C probably damaging Het
Fam186b T A 15: 99,280,428 E339V probably benign Het
Fga T C 3: 83,031,397 F360L probably damaging Het
Fut9 C T 4: 25,619,823 W330* probably null Het
Ghr T C 15: 3,320,409 N429S probably benign Het
Gm5444 A T 13: 4,833,625 noncoding transcript Het
Hjurp G C 1: 88,277,215 probably benign Het
Hoxa5 T C 6: 52,202,679 I239V probably damaging Het
Hps6 T C 19: 46,004,491 V289A possibly damaging Het
Iqcb1 A G 16: 36,843,439 N190D possibly damaging Het
Olfr1115 T C 2: 87,252,873 V312A possibly damaging Het
Olfr607 A G 7: 103,461,086 Y41H probably damaging Het
Pacsin1 A G 17: 27,704,911 E93G possibly damaging Het
Pds5a A G 5: 65,627,079 probably null Het
Ppp1r9b A T 11: 94,996,609 E482D probably damaging Het
Rhobtb3 A G 13: 75,910,852 S276P probably benign Het
Rimbp2 A G 5: 128,789,641 V538A probably benign Het
Rmdn3 A T 2: 119,153,527 probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Slc4a11 A T 2: 130,684,459 V855D probably benign Het
Speer4f1 C A 5: 17,479,524 N183K probably damaging Het
Sstr4 A T 2: 148,396,410 N314Y probably damaging Het
Synj2 A G 17: 6,023,794 K288E probably damaging Het
Trhde T A 10: 114,592,165 N409Y probably damaging Het
Ttn A T 2: 76,781,139 W15604R probably damaging Het
Ugdh C T 5: 65,427,484 V32I possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Vps13d G T 4: 145,148,686 D1750E probably benign Het
Wdfy3 A G 5: 101,888,323 probably benign Het
Wnt4 C A 4: 137,296,520 T266K probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Zfp322a A T 13: 23,357,324 C83S probably damaging Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21921764 missense probably benign 0.00
IGL01092:Map3k13 APN 16 21928016 missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21892123 missense probably benign
IGL02444:Map3k13 APN 16 21914232 missense probably benign 0.19
IGL02503:Map3k13 APN 16 21908704 missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21905255 missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21892231 missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21914225 missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21903756 missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21914157 missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21891988 missense probably benign
R0601:Map3k13 UTSW 16 21905249 missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21906524 missense probably benign 0.03
R0918:Map3k13 UTSW 16 21926240 missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21903792 missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21914189 missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21911086 missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21892144 missense probably benign 0.01
R2361:Map3k13 UTSW 16 21906536 missense probably benign 0.05
R4395:Map3k13 UTSW 16 21898571 missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21922178 missense probably benign 0.00
R4506:Map3k13 UTSW 16 21922178 missense probably benign 0.00
R4521:Map3k13 UTSW 16 21905775 missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21892002 missense probably benign
R4952:Map3k13 UTSW 16 21911019 missense probably benign 0.15
R5035:Map3k13 UTSW 16 21921671 missense probably benign 0.03
R5327:Map3k13 UTSW 16 21921647 missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21898641 missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21928048 makesense probably null
R5996:Map3k13 UTSW 16 21905245 missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21905183 missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21921777 missense probably benign 0.15
R6620:Map3k13 UTSW 16 21892311 missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21892312 missense probably benign 0.32
R6692:Map3k13 UTSW 16 21905237 missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21922278 missense probably benign 0.10
R6743:Map3k13 UTSW 16 21892423 missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21922263 missense probably benign 0.00
R6965:Map3k13 UTSW 16 21922150 missense probably benign
R7149:Map3k13 UTSW 16 21925437 missense probably benign 0.04
R7174:Map3k13 UTSW 16 21926256 missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21892238 missense probably benign 0.03
R7400:Map3k13 UTSW 16 21922322 missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21921686 missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21905871 missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21921596 missense probably benign 0.09
R7876:Map3k13 UTSW 16 21922319 missense probably benign 0.00
R8002:Map3k13 UTSW 16 21905128 missense probably benign 0.05
R8089:Map3k13 UTSW 16 21903817 missense possibly damaging 0.48
R8341:Map3k13 UTSW 16 21921584 nonsense probably null
R8738:Map3k13 UTSW 16 21926258 missense probably damaging 1.00
R8940:Map3k13 UTSW 16 21908704 missense possibly damaging 0.50
R8949:Map3k13 UTSW 16 21905132 missense probably benign 0.05
R9391:Map3k13 UTSW 16 21921915 missense probably benign 0.00
Z1176:Map3k13 UTSW 16 21905162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGAAATCTCAGAGCTGC -3'
(R):5'- TAGCACACACTAGCACTGTGC -3'

Sequencing Primer
(F):5'- ATCTCAGAGCTGCAATGGCTG -3'
(R):5'- CACTGTGCTAAGCCTATCAAGGG -3'
Posted On 2014-10-30