Mutagenetix > Incidental Mutations

Incidental Mutation 'R2332:Cep250'

246456

Institutional Source

Beutler Lab

Gene Symbol

Cep250

Ensembl Gene

ENSMUSG00000038241

Gene Name

centrosomal protein 250

Synonyms

Cep2, Inmp, B230210E21Rik

MMRRC Submission

040322-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

155956458-155998900 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 155990607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1483 (E1483G)

Ref Sequence

ENSEMBL: ENSMUSP00000038255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039994] [ENSMUST00000094421] [ENSMUST00000109619] [ENSMUST00000124812] [ENSMUST00000128683]

AlphaFold

Q60952

Predicted Effect

probably damaging
Transcript: ENSMUST00000039994
AA Change: E1483G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241
AA Change: E1483G

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	4.2e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	327	N/A	INTRINSIC
internal_repeat_1	444	460	1.47e-18	PROSPERO
internal_repeat_1	465	481	1.47e-18	PROSPERO
low complexity region	495	506	N/A	INTRINSIC
low complexity region	557	580	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	635	650	N/A	INTRINSIC
low complexity region	669	677	N/A	INTRINSIC
low complexity region	688	703	N/A	INTRINSIC
low complexity region	708	719	N/A	INTRINSIC
low complexity region	896	914	N/A	INTRINSIC
low complexity region	990	1007	N/A	INTRINSIC
low complexity region	1043	1053	N/A	INTRINSIC
low complexity region	1138	1143	N/A	INTRINSIC
low complexity region	1182	1195	N/A	INTRINSIC
coiled coil region	1257	1687	N/A	INTRINSIC
low complexity region	1872	1895	N/A	INTRINSIC
low complexity region	1919	1933	N/A	INTRINSIC
low complexity region	1941	1960	N/A	INTRINSIC
internal_repeat_2	2002	2052	3.9e-6	PROSPERO
coiled coil region	2068	2169	N/A	INTRINSIC
coiled coil region	2196	2217	N/A	INTRINSIC
coiled coil region	2251	2310	N/A	INTRINSIC
low complexity region	2325	2338	N/A	INTRINSIC
coiled coil region	2340	2366	N/A	INTRINSIC
low complexity region	2379	2388	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000094421
AA Change: E1463G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241
AA Change: E1463G

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	5.4e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	357	N/A	INTRINSIC
coiled coil region	400	1165	N/A	INTRINSIC
coiled coil region	1237	1667	N/A	INTRINSIC
low complexity region	1852	1875	N/A	INTRINSIC
low complexity region	1899	1913	N/A	INTRINSIC
low complexity region	1921	1940	N/A	INTRINSIC
internal_repeat_1	1982	2032	3.35e-6	PROSPERO
coiled coil region	2048	2149	N/A	INTRINSIC
coiled coil region	2176	2197	N/A	INTRINSIC
coiled coil region	2231	2290	N/A	INTRINSIC
low complexity region	2305	2318	N/A	INTRINSIC
coiled coil region	2320	2346	N/A	INTRINSIC
low complexity region	2359	2368	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109619
AA Change: E1484G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241
AA Change: E1484G

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	214	4.1e-60	PFAM
low complexity region	215	225	N/A	INTRINSIC
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	357	N/A	INTRINSIC
internal_repeat_1	445	461	1.51e-18	PROSPERO
internal_repeat_1	466	482	1.51e-18	PROSPERO
low complexity region	496	507	N/A	INTRINSIC
low complexity region	558	581	N/A	INTRINSIC
low complexity region	584	596	N/A	INTRINSIC
low complexity region	636	651	N/A	INTRINSIC
low complexity region	670	678	N/A	INTRINSIC
low complexity region	689	704	N/A	INTRINSIC
low complexity region	709	720	N/A	INTRINSIC
low complexity region	897	915	N/A	INTRINSIC
low complexity region	991	1008	N/A	INTRINSIC
low complexity region	1044	1054	N/A	INTRINSIC
low complexity region	1139	1144	N/A	INTRINSIC
low complexity region	1183	1196	N/A	INTRINSIC
coiled coil region	1258	1688	N/A	INTRINSIC
low complexity region	1873	1896	N/A	INTRINSIC
low complexity region	1920	1934	N/A	INTRINSIC
low complexity region	1942	1961	N/A	INTRINSIC
internal_repeat_2	2003	2053	3.95e-6	PROSPERO
coiled coil region	2069	2170	N/A	INTRINSIC
coiled coil region	2197	2218	N/A	INTRINSIC
coiled coil region	2252	2311	N/A	INTRINSIC
low complexity region	2326	2339	N/A	INTRINSIC
coiled coil region	2341	2367	N/A	INTRINSIC
low complexity region	2380	2389	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124812

Predicted Effect

probably benign
Transcript: ENSMUST00000128683

SMART Domains

Protein: ENSMUSP00000119845
Gene: ENSMUSG00000038241

Domain	Start	End	E-Value	Type
coiled coil region	2	37	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148191

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149905

Predicted Effect

probably benign
Transcript: ENSMUST00000156355

SMART Domains

Protein: ENSMUSP00000122223
Gene: ENSMUSG00000038241

Domain	Start	End	E-Value	Type
coiled coil region	12	47	N/A	INTRINSIC
coiled coil region	119	223	N/A	INTRINSIC

Meta Mutation Damage Score

0.0767

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc	T	C	18: 34,317,059	I2302T	possibly damaging	Het
Apoa4	G	A	9: 46,242,355	V85I	probably benign	Het
Banf1	C	T	19: 5,365,030	W84*	probably null	Het
Cdk13	A	G	13: 17,718,695	L627P	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ddx60	A	G	8: 62,037,091	E1698G	probably benign	Het
Depdc1a	C	A	3: 159,523,866	Q612K	probably damaging	Het
Dnaja2	G	A	8: 85,540,136	R321C	probably damaging	Het
Fam186b	T	A	15: 99,280,428	E339V	probably benign	Het
Fga	T	C	3: 83,031,397	F360L	probably damaging	Het
Fut9	C	T	4: 25,619,823	W330*	probably null	Het
Ghr	T	C	15: 3,320,409	N429S	probably benign	Het
Gm5444	A	T	13: 4,833,625		noncoding transcript	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Hoxa5	T	C	6: 52,202,679	I239V	probably damaging	Het
Hps6	T	C	19: 46,004,491	V289A	possibly damaging	Het
Iqcb1	A	G	16: 36,843,439	N190D	possibly damaging	Het
Map3k13	G	A	16: 21,898,677		probably null	Het
Olfr1115	T	C	2: 87,252,873	V312A	possibly damaging	Het
Olfr607	A	G	7: 103,461,086	Y41H	probably damaging	Het
Pacsin1	A	G	17: 27,704,911	E93G	possibly damaging	Het
Pds5a	A	G	5: 65,627,079		probably null	Het
Ppp1r9b	A	T	11: 94,996,609	E482D	probably damaging	Het
Rhobtb3	A	G	13: 75,910,852	S276P	probably benign	Het
Rimbp2	A	G	5: 128,789,641	V538A	probably benign	Het
Rmdn3	A	T	2: 119,153,527		probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Slc4a11	A	T	2: 130,684,459	V855D	probably benign	Het
Speer4f1	C	A	5: 17,479,524	N183K	probably damaging	Het
Sstr4	A	T	2: 148,396,410	N314Y	probably damaging	Het
Synj2	A	G	17: 6,023,794	K288E	probably damaging	Het
Trhde	T	A	10: 114,592,165	N409Y	probably damaging	Het
Ttn	A	T	2: 76,781,139	W15604R	probably damaging	Het
Ugdh	C	T	5: 65,427,484	V32I	possibly damaging	Het
Uhrf1	C	A	17: 56,310,671		probably null	Het
Vps13d	G	T	4: 145,148,686	D1750E	probably benign	Het
Wdfy3	A	G	5: 101,888,323		probably benign	Het
Wnt4	C	A	4: 137,296,520	T266K	probably benign	Het
Wtap	C	T	17: 12,967,538	R374Q	possibly damaging	Het
Zfp322a	A	T	13: 23,357,324	C83S	probably damaging	Het

Other mutations in Cep250

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Cep250	APN	2	155991329	missense	probably benign	0.00
IGL01077:Cep250	APN	2	155962134	missense	probably damaging	1.00
IGL01084:Cep250	APN	2	155998393	missense	probably benign	0.00
IGL01400:Cep250	APN	2	155998291	missense	possibly damaging	0.78
IGL01570:Cep250	APN	2	155967663	splice site	probably benign
IGL01583:Cep250	APN	2	155976149	missense	probably damaging	0.99
IGL01590:Cep250	APN	2	155992317	missense	possibly damaging	0.80
IGL01647:Cep250	APN	2	155983376	missense	probably benign	0.02
IGL01959:Cep250	APN	2	155983359	missense	possibly damaging	0.63
IGL02066:Cep250	APN	2	155976521	missense	probably damaging	1.00
IGL02219:Cep250	APN	2	155991594	missense	probably benign	0.26
IGL02322:Cep250	APN	2	155990328	missense	probably damaging	1.00
IGL02728:Cep250	APN	2	155983278	unclassified	probably benign
IGL02955:Cep250	APN	2	155975756	missense	probably benign	0.01
IGL03369:Cep250	APN	2	155990271	missense	probably benign	0.00
R0366:Cep250	UTSW	2	155988401	missense	probably benign	0.00
R0403:Cep250	UTSW	2	155992349	missense	probably damaging	0.99
R0441:Cep250	UTSW	2	155972004	missense	possibly damaging	0.82
R0482:Cep250	UTSW	2	155964974	splice site	probably benign
R0507:Cep250	UTSW	2	155992532	missense	possibly damaging	0.60
R0614:Cep250	UTSW	2	155970097	nonsense	probably null
R0855:Cep250	UTSW	2	155964111	missense	probably damaging	1.00
R0973:Cep250	UTSW	2	155964289	splice site	probably benign
R1137:Cep250	UTSW	2	155990840	missense	probably benign	0.05
R1270:Cep250	UTSW	2	155990681	missense	probably benign	0.01
R1313:Cep250	UTSW	2	155972079	missense	probably damaging	0.98
R1313:Cep250	UTSW	2	155972079	missense	probably damaging	0.98
R1470:Cep250	UTSW	2	155991075	missense	probably damaging	0.99
R1470:Cep250	UTSW	2	155991075	missense	probably damaging	0.99
R1703:Cep250	UTSW	2	155965546	missense	probably benign	0.23
R1705:Cep250	UTSW	2	155963786	missense	probably damaging	1.00
R1740:Cep250	UTSW	2	155973356	missense	probably damaging	0.99
R1796:Cep250	UTSW	2	155992187	missense	possibly damaging	0.88
R1897:Cep250	UTSW	2	155976095	missense	probably damaging	1.00
R1900:Cep250	UTSW	2	155985374	critical splice donor site	probably null
R1958:Cep250	UTSW	2	155976381	splice site	probably null
R1974:Cep250	UTSW	2	155989504	missense	probably damaging	0.96
R2015:Cep250	UTSW	2	155981453	missense	probably damaging	0.96
R2033:Cep250	UTSW	2	155970892	missense	probably damaging	0.99
R2224:Cep250	UTSW	2	155991817	missense	possibly damaging	0.94
R2266:Cep250	UTSW	2	155976170	missense	probably benign	0.13
R2278:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2364:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2366:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2367:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2385:Cep250	UTSW	2	155974341	missense	probably damaging	1.00
R2830:Cep250	UTSW	2	155983316	missense	probably benign	0.00
R2895:Cep250	UTSW	2	155992122	missense	probably benign	0.00
R2965:Cep250	UTSW	2	155994878	missense	probably benign	0.44
R2966:Cep250	UTSW	2	155994878	missense	probably benign	0.44
R3016:Cep250	UTSW	2	155991288	missense	probably damaging	1.00
R3052:Cep250	UTSW	2	155991048	missense	probably damaging	0.99
R3424:Cep250	UTSW	2	155981461	missense	probably benign	0.02
R3930:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4085:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4087:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4088:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4090:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4110:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4355:Cep250	UTSW	2	155991525	missense	probably damaging	1.00
R4601:Cep250	UTSW	2	155962053	missense	probably benign	0.10
R4721:Cep250	UTSW	2	155970199	missense	probably damaging	1.00
R4995:Cep250	UTSW	2	155988316	missense	probably damaging	1.00
R5053:Cep250	UTSW	2	155962928	missense	possibly damaging	0.77
R5090:Cep250	UTSW	2	155976404	missense	probably damaging	1.00
R5744:Cep250	UTSW	2	155981474	missense	possibly damaging	0.60
R5775:Cep250	UTSW	2	155969374	missense	possibly damaging	0.92
R5986:Cep250	UTSW	2	155979277	missense	probably damaging	1.00
R6112:Cep250	UTSW	2	155994583	missense	possibly damaging	0.95
R6152:Cep250	UTSW	2	155981438	missense	possibly damaging	0.94
R6823:Cep250	UTSW	2	155981459	missense	probably benign	0.02
R6859:Cep250	UTSW	2	155992526	missense	probably benign	0.24
R6900:Cep250	UTSW	2	155996270	critical splice acceptor site	probably null
R7107:Cep250	UTSW	2	155995394	missense	probably benign	0.00
R7131:Cep250	UTSW	2	155965077	missense	probably damaging	1.00
R7178:Cep250	UTSW	2	155973455	nonsense	probably null
R7241:Cep250	UTSW	2	155991552	missense	probably benign	0.20
R7264:Cep250	UTSW	2	155979151	missense	probably damaging	0.99
R7290:Cep250	UTSW	2	155992762	missense	probably benign	0.03
R7367:Cep250	UTSW	2	155969307	missense	probably benign	0.00
R7397:Cep250	UTSW	2	155981411	missense	probably damaging	0.99
R7768:Cep250	UTSW	2	155986009	missense
R7823:Cep250	UTSW	2	155965416	missense	possibly damaging	0.89
R8152:Cep250	UTSW	2	155969307	missense	probably benign	0.00
R8331:Cep250	UTSW	2	155990253	missense	probably damaging	1.00
R8559:Cep250	UTSW	2	155992736	missense	probably damaging	0.99
R8972:Cep250	UTSW	2	155970122	missense	unknown
R8973:Cep250	UTSW	2	155970122	missense	unknown
R8974:Cep250	UTSW	2	155970122	missense	unknown
R8975:Cep250	UTSW	2	155970122	missense	unknown
R8976:Cep250	UTSW	2	155970122	missense	unknown
R9072:Cep250	UTSW	2	155992115	missense	probably benign	0.01
R9123:Cep250	UTSW	2	155970122	missense	unknown
R9127:Cep250	UTSW	2	155970122	missense	unknown
R9128:Cep250	UTSW	2	155970122	missense	unknown
R9167:Cep250	UTSW	2	155987000	missense
R9189:Cep250	UTSW	2	155976430	missense	probably benign	0.00
R9198:Cep250	UTSW	2	155988434	critical splice donor site	probably null
R9227:Cep250	UTSW	2	155970122	missense	unknown
R9228:Cep250	UTSW	2	155970122	missense	unknown
R9292:Cep250	UTSW	2	155990768	missense	probably damaging	0.99
X0061:Cep250	UTSW	2	155961985	missense	probably benign	0.05
Z1177:Cep250	UTSW	2	155976467	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CAGGCTTTACAAGAACAGGGTG -3'
(R):5'- CCTCTGGGACTCAATCACTTG -3'

Sequencing Primer
(F):5'- CTTTACAAGAACAGGGTGAGCTG -3'
(R):5'- TTCTGCTCCAGGTCCAGAAG -3'

Posted On

2014-10-30