Incidental Mutation 'R3149:Septin4'
ID 264362
Institutional Source Beutler Lab
Gene Symbol Septin4
Ensembl Gene ENSMUSG00000020486
Gene Name septin 4
Synonyms Gm11492, ARTS, septin H5, cell division control-related protein 2b, Sept4, Bh5, Pnutl2
MMRRC Submission 040601-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.768) question?
Stock # R3149 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 87457515-87481365 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87458070 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000053087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060360] [ENSMUST00000122945]
AlphaFold P28661
Q5ND19
Predicted Effect possibly damaging
Transcript: ENSMUST00000060360
AA Change: V148A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053087
Gene: ENSMUSG00000090107
AA Change: V148A

DomainStartEndE-ValueType
Pfam:DUF4655 13 369 1.7e-99 PFAM
Pfam:DUF4655 366 509 2.7e-68 PFAM
low complexity region 511 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122945
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Meta Mutation Damage Score 0.1069 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null males are sterile and have immotile and structurally defective sperm that is bent and lacks the annulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg3 G A 17: 57,183,348 (GRCm39) A30T probably benign Het
Atox1 A G 11: 55,341,379 (GRCm39) L52P possibly damaging Het
Cel T C 2: 28,446,143 (GRCm39) D576G probably benign Het
Csf2ra C A 19: 61,215,758 (GRCm39) A16S possibly damaging Het
Cyp4f18 T C 8: 72,747,044 (GRCm39) D317G possibly damaging Het
Dus1l T C 11: 120,683,930 (GRCm39) T173A possibly damaging Het
Dzip1 T C 14: 119,148,780 (GRCm39) T300A probably benign Het
Ggta1 A T 2: 35,292,635 (GRCm39) I224N probably damaging Het
Gm5150 A G 3: 16,060,479 (GRCm39) L3P probably damaging Het
Gm5592 A G 7: 40,937,804 (GRCm39) E362G probably benign Het
Gm7137 T C 10: 77,623,839 (GRCm39) probably benign Het
Gpatch2l A G 12: 86,291,089 (GRCm39) T91A possibly damaging Het
Hoxa13 G T 6: 52,237,284 (GRCm39) probably benign Het
Ift46 A G 9: 44,695,045 (GRCm39) D65G probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Mapk11 T C 15: 89,029,653 (GRCm39) probably null Het
Mettl25 T C 10: 105,662,214 (GRCm39) D252G probably benign Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Or10ab4 C T 7: 107,654,989 (GRCm39) R267C probably benign Het
Pecam1 A G 11: 106,575,107 (GRCm39) V601A possibly damaging Het
Prkx A T X: 76,814,881 (GRCm39) F260I probably damaging Het
Rassf9 A T 10: 102,380,687 (GRCm39) D21V possibly damaging Het
Rmnd5a T A 6: 71,406,085 (GRCm39) I68L probably benign Het
Rock2 T C 12: 17,015,092 (GRCm39) S762P probably damaging Het
Srgap2 T C 1: 131,220,327 (GRCm39) T216A probably benign Het
Tasor2 G A 13: 3,624,359 (GRCm39) P1182S probably damaging Het
Vmn1r86 T A 7: 12,836,358 (GRCm39) K123* probably null Het
Vmn2r68 A C 7: 84,886,875 (GRCm39) V13G probably benign Het
Vps13d G C 4: 144,853,147 (GRCm39) N2322K possibly damaging Het
Xpo5 A G 17: 46,553,173 (GRCm39) probably null Het
Zswim9 T C 7: 13,011,196 (GRCm39) T51A possibly damaging Het
Other mutations in Septin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Septin4 APN 11 87,480,599 (GRCm39) missense probably damaging 1.00
IGL00963:Septin4 APN 11 87,474,199 (GRCm39) missense possibly damaging 0.89
IGL01803:Septin4 APN 11 87,459,075 (GRCm39) missense probably benign 0.07
IGL01993:Septin4 APN 11 87,458,555 (GRCm39) missense possibly damaging 0.85
IGL02566:Septin4 APN 11 87,458,468 (GRCm39) missense probably benign 0.00
IGL03087:Septin4 APN 11 87,476,071 (GRCm39) splice site probably benign
IGL03213:Septin4 APN 11 87,458,184 (GRCm39) splice site probably null
IGL03268:Septin4 APN 11 87,480,529 (GRCm39) missense probably damaging 0.99
IGL03388:Septin4 APN 11 87,459,042 (GRCm39) nonsense probably null
R0050:Septin4 UTSW 11 87,458,172 (GRCm39) missense probably damaging 1.00
R0077:Septin4 UTSW 11 87,472,022 (GRCm39) missense probably benign
R1479:Septin4 UTSW 11 87,458,244 (GRCm39) missense probably damaging 1.00
R1729:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1730:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1739:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1762:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1783:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1784:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1785:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1851:Septin4 UTSW 11 87,459,741 (GRCm39) missense probably damaging 1.00
R1862:Septin4 UTSW 11 87,458,061 (GRCm39) missense possibly damaging 0.48
R1913:Septin4 UTSW 11 87,457,838 (GRCm39) missense probably benign
R1957:Septin4 UTSW 11 87,481,193 (GRCm39) missense probably benign 0.02
R2131:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2133:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2140:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2141:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2252:Septin4 UTSW 11 87,480,637 (GRCm39) missense possibly damaging 0.75
R3176:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3276:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3696:Septin4 UTSW 11 87,476,060 (GRCm39) missense possibly damaging 0.48
R4018:Septin4 UTSW 11 87,475,947 (GRCm39) missense probably damaging 1.00
R4021:Septin4 UTSW 11 87,458,106 (GRCm39) missense probably damaging 1.00
R4117:Septin4 UTSW 11 87,459,108 (GRCm39) missense probably damaging 1.00
R4193:Septin4 UTSW 11 87,474,142 (GRCm39) critical splice acceptor site probably null
R4196:Septin4 UTSW 11 87,479,598 (GRCm39) missense probably damaging 0.96
R4332:Septin4 UTSW 11 87,458,730 (GRCm39) missense possibly damaging 0.95
R4515:Septin4 UTSW 11 87,458,883 (GRCm39) missense probably benign
R4663:Septin4 UTSW 11 87,458,429 (GRCm39) missense probably damaging 0.98
R4952:Septin4 UTSW 11 87,458,598 (GRCm39) missense probably benign 0.00
R5012:Septin4 UTSW 11 87,475,230 (GRCm39) missense possibly damaging 0.78
R5015:Septin4 UTSW 11 87,458,043 (GRCm39) missense possibly damaging 0.95
R5149:Septin4 UTSW 11 87,480,071 (GRCm39) missense probably damaging 1.00
R5176:Septin4 UTSW 11 87,458,358 (GRCm39) missense probably benign 0.02
R5711:Septin4 UTSW 11 87,458,723 (GRCm39) missense probably benign 0.07
R5891:Septin4 UTSW 11 87,479,750 (GRCm39) unclassified probably benign
R6090:Septin4 UTSW 11 87,480,343 (GRCm39) missense possibly damaging 0.48
R6145:Septin4 UTSW 11 87,476,072 (GRCm39) splice site probably null
R6257:Septin4 UTSW 11 87,481,175 (GRCm39) missense probably benign 0.07
R6305:Septin4 UTSW 11 87,458,145 (GRCm39) missense probably benign 0.00
R6704:Septin4 UTSW 11 87,479,856 (GRCm39) missense probably damaging 1.00
R7064:Septin4 UTSW 11 87,481,193 (GRCm39) missense probably benign 0.02
R7090:Septin4 UTSW 11 87,475,264 (GRCm39) missense probably damaging 1.00
R7784:Septin4 UTSW 11 87,469,834 (GRCm39) missense probably benign
R7790:Septin4 UTSW 11 87,480,065 (GRCm39) missense probably damaging 1.00
R8320:Septin4 UTSW 11 87,480,560 (GRCm39) missense possibly damaging 0.68
R9289:Septin4 UTSW 11 87,459,792 (GRCm39) nonsense probably null
R9613:Septin4 UTSW 11 87,469,823 (GRCm39) missense possibly damaging 0.53
T0970:Septin4 UTSW 11 87,458,558 (GRCm39) missense probably damaging 0.98
Z1177:Septin4 UTSW 11 87,458,748 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGACTACCTACACCCTGTG -3'
(R):5'- ATGCTGAAATCCTACGGGGTAC -3'

Sequencing Primer
(F):5'- TGTGTCCCCACAGCCAG -3'
(R):5'- CTGAAATCCTACGGGGTACTTTAACC -3'
Posted On 2015-02-05